BDgene

Other Variant

Search by:

Total result: 918

Variant Name Variant Type Location in Gene Related Gene No. of Studies (Positive/Negative/Trend) Overlap with SZ Overlap with MDD
5HTTLPR microsatellite promoter SLC6A4 41 (12/29/0) YES YES
BDNF Val66Met point mutation BDNF 21 (11/10/0) YES YES
SLC6A4 intron2 VNTR VNTR intron2 SLC6A4 16 (4/12/0) YES YES
COMT Val158Met point mutation COMT 14 (2/12/0) NO YES
MTHFR C677T point mutation MTHFR 13 (5/8/0) YES YES
MAOA promoter VNTR VNTR promoter MAOA 9 (0/9/0) NO YES
DRD3 Ser9Gly point mutation DRD3 9 (2/7/0) NO YES
HTR2A C102T point mutation HTR2A 8 (0/8/0) YES YES
MAOA (CA)n microsatellite MAOA 8 (5/3/0) NO YES
DRD4 exon3 VNTR VNTR exon3 DRD4 8 (1/7/0) YES YES
TPH1 A218C point mutation intron 7 TPH1 6 (2/4/0) YES YES
DRD3 BalI Polymorphism point mutation DRD3 6 (1/5/0) NO NO
5-HTT intron 2 VNTR VNTR SLC6A4 5 (1/4/0) NO YES
TH intron 1 tetranucleotide repeat duplication intron 1 TH 5 (0/5/0) NO YES
DRD1 -48A/G point mutation DRD1 5 (3/2/0) YES NO
DRD2 S311C point mutation DRD2 5 (0/5/0) YES YES
HTR2A -1438A/G point mutation HTR2A 4 (1/3/0) NO YES
SERT VNTR VNTR SLC6A4 4 (2/2/0) YES YES
ACE insertion/deletion insertion/deletion ACE 4 (2/2/0) YES YES
KCNN3 exon 1 CAG-repeat microsatellite exon 1 KCNN3 4 (0/4/0) YES NO
TH TaqI Polymorphism SNP TH 4 (2/2/0) NO YES
MTHFR A1298C point mutation MTHFR 4 (3/1/0) YES YES
rs6195 point mutation NR3C1 3 (0/3/0) NO YES
HTR2A 516C/T point mutation HTR2A 3 (1/2/0) NO NO
HTR2A His452Tyr point mutation HTR2A 3 (0/3/0) NO NO
HTR2C Cys23Ser point mutation HTR2C 3 (3/0/0) NO YES
BDNF 196G/A point mutation BDNF 3 (2/1/0) NO NO
BDNF (GT)n microsatellite BDNF 3 (2/1/0) YES YES
TCF4 CTG18.1 microsatellite TCF4 3 (1/2/0) YES NO
TH PstI Polymorphism SNP TH 3 (0/3/0) NO YES
WFS1 G576S point mutation exon8 WFS1 3 (0/3/0) NO YES
WFS1 H611R point mutation exon8 WFS1 3 (0/3/0) NO YES
MAOA RFLP point mutation MAOA 3 (1/2/0) NO NO
MAOA T941G point mutation MAOA 3 (2/1/0) YES YES
MAOB (GT)n microsatellite MAOB 3 (1/2/0) NO YES
DAT VNTR VNTR SLC6A3 3 (0/3/0) NO NO
DDC 1bp del insertion/deletion DDC 3 (2/1/0) NO YES
XBP1 -116C>G point mutation XBP1 3 (1/2/0) NO NO
DDC 4bp del insertion/deletion DDC 3 (1/2/0) NO YES
DRD2 141ins/del insertion/deletion DRD2 3 (1/2/0) NO NO
DRD2 TaqIA point mutation DRD2 3 (1/2/0) NO NO
DRD2 TaqI Polymorphism SNP DRD2 3 (0/3/0) NO NO
ERDA1 microsatellite microsatellite ERDA1 3 (0/3/0) YES NO
NRG1 SNP8NRG241930 point mutation NRG1 3 (0/3/0) YES NO
NRG1 SNP8NRG243177 point mutation NRG1 3 (0/3/0) YES NO
GPR50 delta502-505 insertion/deletion GPR50 3 (1/2/0) YES YES
GSK3B -1727A/T point mutation promoter GSK3B 3 (0/3/0) YES NO
GSK3B -50T/C point mutation promoter GSK3B 3 (0/3/0) YES NO
RGS4 SNP1 point mutation RGS4 2 (0/2/0) YES NO
5-HT2A His452Tyr point mutation in the intracellular C-terminal end of the 5-HT2A protein HTR2A 2 (1/1/0) NO NO
5-HT2A T102C point mutation HTR2A 2 (0/2/0) NO NO
HTR2A Thr25Asn point mutation HTR2A 2 (0/2/0) NO NO
ADCY9 2316A>G point mutation ADCY9 2 (1/1/0) NO YES
ADCY9 (TTTA)n microsatellite ADCY9 2 (1/1/0) NO YES
SLC6A3 -67A/T point mutation SLC6A3 2 (2/0/0) NO NO
HTR6 267C/T point mutation HTR6 2 (1/1/0) YES YES
IL1RN intron 2 VNTR VNTR intron 2 IL1RN 2 (1/1/0) YES NO
IMPA2 -185A>G point mutation IMPA2 2 (0/2/0) YES NO
IMPA2 -207T>C point mutation IMPA2 2 (2/0/0) YES NO
SYBL1 intron5 G>C point mutation intron5 VAMP7 2 (0/2/0) NO NO
IMPA2 443G>A (R148Q) point mutation IMPA2 2 (0/2/0) NO NO
IMPA2 -461C>T point mutation IMPA2 2 (1/1/0) NO NO
BDNF-LCPR microsatellite approximately 1.0 kb upstream of the translation initiation site of the BDNF gene BDNF 2 (1/1/0) NO NO
IMPA2 -97-15G>A point mutation IMPA2 2 (0/2/0) NO NO
TH BglII Polymorphism SNP TH 2 (2/0/0) NO NO
COMT H/L others COMT 2 (1/1/0) NO YES
TH TaqI RFLP RFLP TH 2 (1/1/0) NO NO
TNF -G308A point mutation TNF 2 (1/1/0) YES NO
TPH1 intron 7 218A/C SNP intron 7 TPH1 2 (0/2/0) NO YES
DAT 40bp repeat duplication SLC6A3 2 (0/2/0) NO YES
MAOA VNTR VNTR MAOA 2 (2/0/0) NO NO
mtDNA A10398G point mutation mtDNA 2 (1/1/0) NO NO
mtDNA C5178A point mutation mtDNA 2 (1/1/0) NO NO
DRD1 1403T/C point mutation DRD1 2 (1/1/0) NO NO
NDUFV2 -233T>C point mutation NDUFV2 2 (0/2/0) NO NO
DRD1 -800T/C point mutation DRD1 2 (1/1/0) NO NO
NDUFV2 -602G>A point mutation NDUFV2 2 (1/1/0) NO NO
NDUFV2 -796C>G point mutation NDUFV2 2 (0/2/0) NO NO
NDUFV2 86C>T point mutation NDUFV2 2 (0/2/0) NO NO
DRD2 RFLP SNP DRD2 2 (0/2/0) NO NO
DRD4 -521T/C point mutation DRD4 2 (0/2/0) NO NO
NOS1 promoter VNTR VNTR promoter NOS1 2 (0/2/0) YES NO
NOTCH4 (CTG)n microsatellite NOTCH4 2 (1/1/0) NO NO
NRG1 420M9-1395 microsatellite NRG1 2 (0/2/0) NO NO
NRG1 478B14-848 microsatellite NRG1 2 (0/2/0) NO NO
NRG1 SNP8NRG221533 point mutation NRG1 2 (0/2/0) YES NO
GRIN2B -200G/T point mutation GRIN2B 2 (0/2/0) YES NO
PLA2 1-8 allele duplication PLA2G1B 2 (0/2/0) NO NO
PLA2G1B microsatellite polymorphisms microsatellite PLA2G1B 2 (2/0/0) NO NO
HARS TaqI Polymorphism SNP HARS 1 (0/1/0) NO NO
PRODH-2026 point mutation PRODH 1 (0/1/0) YES NO
CACNA1C Chr12:2335301 -/G/A insertion/deletion CACNA1C 1 (0/1/0) NO NO
HDAT-PCR1 SNP SLC6A3 1 (1/0/0) NO NO
PRODH exon12 A472T point mutation exon12 PRODH 1 (0/1/0) YES NO
CACNA1C Chr12:2335333 -/ACACACAG/ACACACAC insertion/deletion CACNA1C 1 (0/1/0) NO NO
218C10.CA44 microsatellite 21q23 1 (0/1/0) NO NO
hKCa CAG repeat duplication KCNN3 1 (0/1/0) NO NO
PRODH exon12 R431H point mutation exon12 PRODH 1 (0/1/0) YES NO
CACNA1C Chr12:2335340 -/G/C insertion/deletion CACNA1C 1 (0/1/0) NO NO
22A5.GT124 microsatellite 21q23 1 (0/1/0) NO NO
HLA-A polymorphism others HLA-A 1 (0/1/0) NO NO
RFX4 D12S2072 microsatellite RFX4 1 (1/0/0) NO NO
CACNA1C Chr12:2336695 G/A point mutation CACNA1C 1 (0/1/0) NO NO
22CH3 CAG repeat microsatellite 1 (1/0/0) YES NO
HLA-B polymorphism others HLA-B 1 (0/1/0) NO NO
RGS4 SNP18 point mutation RGS4 1 (0/1/0) YES NO
CACNA1C Chr12:2338101 -/TA/TATG insertion/deletion CACNA1C 1 (0/1/0) NO NO
-2 bp deletion polymorphism insertion/deletion 1 Mb apart from CHRNA7 CHRNA7 1 (1/0/0) NO NO
HM74a GC09E01A point mutation HCAR2 1 (0/1/0) NO NO
CACNA1C Chr12:2338102 -/TG insertion/deletion CACNA1C 1 (0/1/0) NO NO
314n7CA23 microsatellite 21q23 1 (0/1/0) NO NO
HM74a GC09E01B point mutation HCAR2 1 (0/1/0) NO NO
RGS4 SNP4 point mutation RGS4 1 (0/1/0) YES NO
CACNA1C Chr12:2338946 G/A point mutation CACNA1C 1 (0/1/0) NO NO
314n7CA28 microsatellite 21q23 1 (0/1/0) NO NO
HM74 GC10E01A point mutation HCAR3 1 (0/1/0) NO NO
RGS4 SNP7 point mutation RGS4 1 (1/0/0) YES NO
CACNA1C Chr12:2339781 G/C point mutation CACNA1C 1 (0/1/0) NO NO
314n7CT18 microsatellite 21q23 1 (0/1/0) NO NO
HM74 GC10E01B point mutation HCAR3 1 (0/1/0) NO NO
rs1129647 point mutation GABRA1 1 (1/0/0) NO YES
CACNA1C Chr12:2341084 -/T insertion/deletion CACNA1C 1 (0/1/0) NO NO
HM74 GC10E01C point mutation HCAR3 1 (0/1/0) NO NO
rs1599988 point mutation mtDNA 1 (1/0/0) YES NO
CACNA1C Chr12:2341393 -/G insertion/deletion CACNA1C 1 (0/1/0) NO NO
5-HT2A promoter 1438A/G point mutation promoter HTR2A 1 (1/0/0) NO NO
HM74 GC10E01D point mutation HCAR3 1 (0/1/0) NO NO
rs28357375 point mutation mtDNA 1 (1/0/0) NO NO
CACNA1C Chr12:2341397 G/T point mutation CACNA1C 1 (0/1/0) NO NO
HM74 GC10E01E point mutation HCAR3 1 (0/1/0) NO NO
rs28357968 point mutation mtDNA 1 (1/0/0) NO NO
CACNA1C Chr12:2347245 -/TT insertion/deletion CACNA1C 1 (0/1/0) NO NO
5-HTR2C RFLP SNP HTR2C 1 (0/1/0) NO NO
HTR1A (CA)n/(GT)n 10 duplication HTR1A 1 (0/1/0) NO NO
rs2853515 point mutation mtDNA 1 (1/0/0) YES NO
CACNA1C Chr12:2349920 -/TGGCCTCCTCA insertion/deletion CACNA1C 1 (0/1/0) NO NO
HTR1B G861C point mutation HTR1B 1 (0/1/0) NO NO
rs3937033 point mutation mtDNA 1 (1/0/0) YES NO
CACNA1C Chr12:2349920 GTGGCCTCCTCAT/GT insertion/deletion CACNA1C 1 (0/1/0) NO NO
HTR1B T371G point mutation HTR1B 1 (0/1/0) NO NO
CACNA1C Chr12:2352902 G/A point mutation CACNA1C 1 (0/1/0) NO NO
5-HTT PstI RFLP SNP SLC6A4 1 (0/1/0) NO NO
HTR1D HincII Polymorphism SNP HTR1D 1 (0/1/0) NO NO
rs6414684 point mutation GABRB1 1 (1/0/0) NO NO
CACNA1C Chr12:2354984 C/T point mutation CACNA1C 1 (0/1/0) NO NO
AADC exon 1 T>A point mutation exon 1 DDC 1 (0/1/0) YES NO
HTR1D TaqI Polymorphism SNP HTR1D 1 (0/1/0) NO NO
rs769404 point mutation GAD1 1 (0/1/0) YES NO
CACNA1C Chr12:2362014 G/C point mutation CACNA1C 1 (0/1/0) NO NO
ABCA13 exon33 H3609P point mutation exon33 ABCA13 1 (0/1/0) YES YES
HTR2A 1018578T/G point mutation HTR2A 1 (0/1/0) NO NO
rs854560 point mutation PON1 1 (1/0/0) NO NO
CACNA1C Chr12:2365088 G/T point mutation CACNA1C 1 (0/1/0) NO NO
ABCA13 exon40 T4031A point mutation exon40 ABCA13 1 (1/0/0) YES YES
HTR2A 1018579A/G point mutation HTR2A 1 (0/1/0) NO NO
RSN GC04E12A point mutation CLIP1 1 (0/1/0) NO NO
CACNA1C Chr12:2365131 C/T point mutation CACNA1C 1 (0/1/0) NO NO
ABCA13 exon52 R4590W point mutation exon52 ABCA13 1 (0/1/0) YES YES
HTR2A 1354C/T point mutation HTR2A 1 (1/0/0) NO NO
RSN GC04E14A point mutation CLIP1 1 (0/1/0) NO NO
CACNA1C Chr12:2370397 -/A insertion/deletion CACNA1C 1 (0/1/0) NO NO
ABCA13 exon52 T4550A point mutation exon52 ABCA13 1 (1/0/0) YES YES
HTR2A 1360020G/T point mutation HTR2A 1 (0/1/0) NO NO
RSN GC04E19A point mutation CLIP1 1 (0/1/0) NO NO
CACNA1C Chr12:2370911 -/ACACAC insertion/deletion CACNA1C 1 (0/1/0) NO NO
ABCA13 exon54 R4728X point mutation exon54 ABCA13 1 (0/1/0) YES YES
S100B-HaeIII microsatellite 21q22.3 1 (0/1/0) NO NO
CACNA1C Chr12:2375362 -/TT insertion/deletion CACNA1C 1 (0/1/0) NO NO
ABCA13 exon57 R4843C point mutation exon57 ABCA13 1 (0/1/0) YES YES
HTR2A 1854352A/G point mutation HTR2A 1 (0/1/0) NO NO
SBNO1 GC22E16A point mutation SBNO1 1 (0/1/0) NO NO
CACNA1C Chr12:2381652 G/A point mutation CACNA1C 1 (0/1/0) NO NO
ABCG1 1248+14insC insertion/deletion ABCG1 1 (0/1/0) NO NO
CACNA1C Chr12:2385027 -/A insertion/deletion CACNA1C 1 (0/1/0) NO NO
ABCG1 1249-64G>T point mutation ABCG1 1 (0/1/0) NO NO
HTR2A 74C/A point mutation HTR2A 1 (0/1/0) NO NO
SCYA2 A-2518G point mutation promoter CCL2 1 (1/0/0) NO YES
CACNA1C Chr12:2385246 G/T point mutation CACNA1C 1 (0/1/0) NO NO
ABCG1 274+11C>T point mutation ABCG1 1 (0/1/0) NO NO
HTR2A BbvI Polymorphism SNP HTR2A 1 (0/1/0) NO NO
SEF2-1B microsatellite 1 (0/1/0) YES NO
CACNA1C Chr12:2389778 G/A point mutation CACNA1C 1 (0/1/0) NO NO
ABCG1 -533A>G point mutation ABCG1 1 (0/1/0) NO NO
SERT insertion/deletion insertion/deletion SLC6A4 1 (1/0/0) NO NO
CACNA1C Chr12:2391029 -/T insertion/deletion CACNA1C 1 (0/1/0) NO NO
ABCG1 576+139A>G point mutation ABCG1 1 (0/1/0) NO NO
CACNA1C Chr12:2392186 -/T insertion/deletion CACNA1C 1 (0/1/0) NO NO
ABCG1 723-20C>T point mutation ABCG1 1 (0/1/0) NO NO
HTR2A HpaII Polymorphism point mutation HTR2A 1 (0/1/0) NO NO
SLC12A6 32416574(G/A) point mutation SLC12A6 1 (1/0/0) YES NO
CACNA1C Chr12:2418658 -/AC insertion/deletion CACNA1C 1 (0/1/0) NO NO
ABCG1 -768G>A point mutation ABCG1 1 (0/1/0) NO NO
HTR2A MspI Polymorphism SNP HTR2A 1 (1/0/0) NO NO
SLC12A6 32418760(G/A) point mutation SLC12A6 1 (1/0/0) YES NO
CACNA1C Chr12:2418658 -/T/TAC insertion/deletion CACNA1C 1 (0/1/0) NO NO
ABCG1 A2424G point mutation ABCG1 1 (0/1/0) NO NO
SLC12A6 IVS4+1008ins(T)/del(T) insertion/deletion SLC12A6 1 (1/0/0) YES NO
CACNA1C Chr12:2418659 AC/ACAC duplication CACNA1C 1 (0/1/0) NO NO
ABCG1 D21S1225 microsatellite ABCG1 1 (1/0/0) NO NO
SLC1A4-11 microsatellite SLC1A4 1 (0/1/0) YES NO
CACNA1C Chr12:2419508 -/A insertion/deletion CACNA1C 1 (0/1/0) NO NO
ABCG1 I6 61VNTR VNTR ABCG1 1 (0/1/0) NO NO
HTR2C GT(12-18)/CT(4-5) microsatellite HTR2C 1 (0/1/0) NO NO
SLC6A3 1342A/G point mutation SLC6A3 1 (0/1/0) NO NO
CACNA1C Chr12:2419516 A/T/AAT point mutation/duplication CACNA1C 1 (0/1/0) NO NO
ABCG1 UTR poly(T) VNTR ABCG1 1 (0/1/0) NO NO
HTR2C HinfI Polymorphism SNP HTR2C 1 (1/0/0) NO NO
SLC6A3 1398-21G/A point mutation SLC6A3 1 (0/1/0) NO NO
CACNA1C Chr12:2421980 -/T insertion/deletion CACNA1C 1 (0/1/0) NO NO
ACE1 dbSNP4295 point mutation ACE 1 (0/1/0) NO NO
HTR3A C178T point mutation HTR3A 1 (1/0/0) NO NO
SLC6A3 1398-56A/G point mutation SLC6A3 1 (0/1/0) NO NO
CACNA1C Chr12:2423175 G/C point mutation Intron CACNA1C 1 (0/1/0) NO NO
HTR3A C195T point mutation HTR3A 1 (0/1/0) NO NO
SLC6A3 1436209 C>G point mutation SLC6A3 1 (0/1/0) NO NO
CACNA1C Chr12:2694668 G/A point mutation Splice site CACNA1C 1 (0/1/0) NO NO
ADARB1 c.2234A>G point mutation exon10 ADARB1 1 (0/1/0) NO NO
HTR3A exon1 Leu10Leu point mutation exon1 HTR3A 1 (0/1/0) YES NO
SLC6A3 1626+14G/A point mutation SLC6A3 1 (0/1/0) NO NO
CACNA1C Chr12:2788668 C/G point mutation CACNA1C 1 (0/1/0) NO NO
HTR3A exon3 A(+7 IVS3)C point mutation exon3 HTR3A 1 (0/1/0) YES NO
SLC6A3 1859C/T point mutation SLC6A3 1 (0/1/0) NO NO
CACNA1C Chr12:2800689 A/G point mutation CACNA1C 1 (0/1/0) NO NO
HTR3A exon6 Leu192Leu point mutation exon6 HTR3A 1 (0/1/0) YES NO
SLC6A3 1967+29insTC insertion/deletion SLC6A3 1 (0/1/0) NO NO
CACNA1C Chr12:2800954 GCACGGGCCACGCCGAGCTCCCGGCCA/- insertion/deletion CACNA1C 1 (0/1/0) NO NO
ADCYAP1 IVS3 37A/T point mutation ADCYAP1 1 (0/1/0) YES NO
HTR3A exon7 Lys277Lys point mutation exon7 HTR3A 1 (0/1/0) YES NO
SLC6A3 242C/T point mutation SLC6A3 1 (0/1/0) NO NO
CACNA1C Chr12:2801016 C/G/CGCCGCCGGGAAGGG point mutation/insertion CACNA1C 1 (0/1/0) NO NO
ADRA1A 492C>T point mutation exon 2 ADRA1A 1 (0/1/0) NO NO
HTR3A exon8 Arg344His point mutation exon8 HTR3A 1 (0/1/0) YES NO
SLC6A3 3'UTR VNTR VNTR 3'UTR SLC6A3 1 (0/1/0) YES NO
CACNA1C Chr12:2801133 T/A point mutation CACNA1C 1 (0/1/0) NO NO
ADRA1B hcv1738292 point mutation ADRA1B 1 (1/0/0) NO NO
HTR3A exon9 Leu459Leu point mutation exon9 HTR3A 1 (0/1/0) YES NO
SLC6A3 547-12C/A point mutation SLC6A3 1 (0/1/0) NO NO
CACNA1C Chr12:2803097 T/G point mutation CACNA1C 1 (0/1/0) NO NO
ADRA2A -1291C>G point mutation ADRA2A 1 (0/1/0) NO NO
HTR3A exon9 Pro391Arg point mutation exon9 HTR3A 1 (0/1/0) YES NO
CACNA1C Chr12:2804191 T/G point mutation CACNA1C 1 (0/1/0) NO NO
ADRA2C 5'UTR (GT)n microsatellite 5' UTR ADRA2C 1 (0/1/0) NO NO
HTR3B 386A>C (Tyr129Ser) point mutation HTR3B 1 (1/0/0) YES NO
SLC6A3 Ala559Val point mutation SLC6A3 1 (0/1/0) NO NO
CACNA1C Chr12:2804268 T/- insertion/deletion CACNA1C 1 (0/1/0) NO NO
AGAT10 microsatellite 21q23 1 (0/1/0) NO NO
HTR3B 547G>A (Val183Ile) point mutation HTR3B 1 (1/0/0) YES NO
SLC6A3 Glu602Gly point mutation SLC6A3 1 (0/1/0) NO NO
CACNA1C Chr12:2804832 G/- insertion/deletion CACNA1C 1 (0/1/0) NO NO
AGT M235T point mutation AGT 1 (1/0/0) NO NO
HTR3B 5'UTR -102delAAG insertion/deletion 5'UTR HTR3B 1 (1/0/0) YES NO
SLC6A3 I11+2478 point mutation SLC6A3 1 (0/1/0) NO NO
CACNA1C Chr12:2806546 G/A point mutation CACNA1C 1 (0/1/0) NO NO
ALDH2 *1/*2 point mutation ALDH2 1 (1/0/0) NO NO
HTR3B IVS4+11C>T point mutation HTR3B 1 (0/1/0) YES NO
SLC6A3 I12+268 point mutation SLC6A3 1 (0/1/0) NO NO
MTHFR exon 4 C677T SNP exon 4 MTHFR 1 (1/0/0) YES NO
ALDH2 *1*2 allele others ALDH2 1 (0/1/0) NO NO
HTR3B IVS4+12G>A point mutation HTR3B 1 (0/1/0) YES NO
SLC6A3 I13+1457 point mutation SLC6A3 1 (1/0/0) NO NO
MTHFR exon 7 A1298C SNP exon 7 MTHFR 1 (1/0/0) YES NO
ALG9 D11S5025 microsatellite ALG9 1 (0/1/0) NO NO
HTR3B IVS6+72A>G point mutation HTR3B 1 (0/1/0) YES NO
SLC6A3 I14+4217 point mutation SLC6A3 1 (0/1/0) NO NO
GRM7 3 6900524 1000G deletion Promoter GRM7 1 (0/1/0) NO NO
ALG9 D11S5026 microsatellite ALG9 1 (0/1/0) NO NO
HTR4 IVS1+15T/C point mutation HTR4 1 (0/1/0) YES YES
SLC6A3 I5+448 point mutation SLC6A3 1 (0/1/0) NO NO
GRM7 3 6901914 1000G deletion Promoter GRM7 1 (0/1/0) NO NO
ALG9 D11S5027 microsatellite ALG9 1 (0/1/0) NO NO
HTR4 IVS3+63C/T point mutation HTR4 1 (0/1/0) YES YES
SLC6A3 I7+922 point mutation SLC6A3 1 (0/1/0) NO NO
GRM7 3 6902624 1000G insertion Promoter GRM7 1 (0/1/0) NO NO
ALG9 D11S5028 microsatellite ALG9 1 (0/1/0) NO NO
HTR4 IVS3+6G/A point mutation HTR4 1 (0/1/0) YES YES
SLC6A3 I8+2086 point mutation SLC6A3 1 (1/0/0) NO NO
GRM7 3f 7313045 point mutation Promoter of ENST00000463676 isoform GRM7 1 (0/1/0) NO NO
ALOX12 R261Q point mutation ALOX12 1 (1/0/0) NO NO
HTR4 IVS4+36T/C point mutation HTR4 1 (0/1/0) YES YES
SLC6A3 P+2459 point mutation SLC6A3 1 (0/1/0) NO NO
GRM7 nPb 7467774 point mutation Promoter of ENST00000458641 isoform GRM7 1 (0/1/0) NO NO
alpha8-alpha10 del insertion/deletion 16.7-kb deletion affecting PCDH-alpha exons 8-10 5q31-linked PCDH family 1 (0/1/0) YES NO
HTR4 SVRSNP1 point mutation HTR4 1 (1/0/0) YES YES
SLC6A4 3'UTR G/T point mutation 3'UTR SLC6A4 1 (0/1/0) NO NO
GRM7 nPa 7493030 indel Promoter of ENST00000458641 isoform GRM7 1 (0/1/0) NO NO
APOE e3/e4 point mutation APOE 1 (1/0/0) NO NO
HTR4 SVRSNP2 point mutation HTR4 1 (1/0/0) YES YES
SLC6A5 AC-tandem-repeat microsatellite SLC6A5 1 (0/1/0) YES NO
GRM7 nex4 7600830 indel Exon of ENST00000458641 isoform GRM7 1 (0/1/0) NO NO
ATP1A3 2-7 allele others ATP1A3 1 (1/0/0) NO NO
HTR4 SVRSNP3 point mutation HTR4 1 (1/0/0) YES YES
SNAP25 promoter SNP1 point mutation promoter SNAP25 1 (0/1/0) NO NO
GRM7 nex7 7649745 insertion Exon of ENST00000458641 isoform GRM7 1 (0/1/0) NO NO
ATP1B3 4E12 microsatellite ATP1B3 1 (0/1/0) NO NO
HTR4 SVRSNP4 point mutation HTR4 1 (1/0/0) YES YES
SNAP29 exon1 56T>C point mutation exon1 SNAP29 1 (0/1/0) YES NO
GRM7 nex8 7678357 point mutation Exon of ENST00000458641 isoform GRM7 1 (0/1/0) NO NO
ATP2A2 exon15 2172G/A point mutation exon15 ATP2A2 1 (0/1/0) NO NO
HTR5A 12A/T point mutation HTR5A 1 (0/1/0) NO YES
SNAP29 exon1 92A>G point mutation exon1 SNAP29 1 (0/1/0) YES NO
GRM7 9c 7698252 point mutation Exon 9 3' UTR GRM7 1 (0/1/0) NO NO
ATP2A2 exon15 2295G/A point mutation exon15 ATP2A2 1 (0/1/0) NO NO
HTR5A 19G/C point mutation HTR5A 1 (0/1/0) NO YES
SNAP29 promoter -849G>A point mutation promoter SNAP29 1 (0/1/0) YES NO
STR Simple T repeat Exon 9 3' UTR GRM7 1 (0/1/0) NO NO
ATP2A2 exon18 2697G/T point mutation exon18 ATP2A2 1 (0/1/0) NO NO
HTR6 126G/T point mutation HTR6 1 (0/1/0) YES NO
SOD2 Ala-9Val point mutation SOD2 1 (0/1/0) NO YES
GRM7 Ex14 Indel insertion Exon 14 GRM7 1 (0/1/0) NO NO
ATP2A2 exon1 87C/T point mutation exon1 ATP2A2 1 (0/1/0) NO NO
SSTR5 -2134delT insertion/deletion SSTR5 1 (0/1/0) NO NO
TACR1 ss825678898 insertion/deletion TACR1 1 (0/1/0) NO NO
ATP2A2 intron3 220-18G/A point mutation intron3 ATP2A2 1 (0/1/0) NO NO
HTR6 873+128A/C point mutation HTR6 1 (1/0/0) YES NO
SSTR5 A-1665G point mutation SSTR5 1 (0/1/0) NO NO
TACR1 Chr2:75280719:D insertion/deletion Regulatory region: ENSR00000676664; Intronic: ENST00000409848, ENST00000305249 TACR1 1 (1/0/0) NO NO
ATP2A2 promoter -2549G/A point mutation promoter ATP2A2 1 (0/1/0) NO NO
HTR6 873+30C/T point mutation HTR6 1 (0/1/0) NO NO
SSTR5 C1004T point mutation SSTR5 1 (1/0/0) NO NO
TACR1 Chr2:75327565:D insertion/deletion Regulatory region: ENSR00001543768; Intronic: ENST00000409848, ENST00000305249 TACR1 1 (1/0/0) NO NO
ATTT11 microsatellite 21q23 1 (0/1/0) NO NO
HTR7 XhoI Polymorphism SNP HTR7 1 (0/1/0) NO NO
SSTR5 C142A point mutation SSTR5 1 (1/0/0) NO NO
TACR1 Chr2:75339547:D insertion/deletion Intronic: ENST00000409848, ENST00000305249 TACR1 1 (1/0/0) NO NO
BDNF 11757C/G point mutation BDNF 1 (1/0/0) NO NO
IFNG 874T/A point mutation IFNG 1 (1/0/0) NO NO
SSTR5 C155T point mutation SSTR5 1 (0/1/0) NO NO
TACR1 Chr2:75359623:D insertion/deletion Intronic: ENST00000409848, ENST00000305249 TACR1 1 (1/0/0) NO NO
BDNF 12910C/A point mutation BDNF 1 (0/1/0) NO NO
IGF1 (CA)n microsatellite IGF1 1 (1/0/0) NO NO
SSTR5 C325T point mutation SSTR5 1 (0/1/0) NO NO
chr2:75561695:D insertion/deletion Intergenic variant 1 (1/0/0) NO NO
BDNF -1360C>T point mutation BDNF 1 (0/1/0) NO NO
IL10 1082G/A point mutation IL10 1 (0/1/0) NO YES
SSTR5 C633T point mutation SSTR5 1 (0/1/0) NO NO
chr2:75618722:I insertion/deletion Intergenic variant 1 (1/0/0) NO NO
BDNF 14569G/A point mutation BDNF 1 (1/0/0) NO NO
SSTR5 C-801G point mutation SSTR5 1 (0/1/0) NO NO
EVA1A chr2:75693696:D insertion/deletion Downstream of ENST00000485891, ENST00000490746 EVA1A 1 (1/0/0) NO NO
BDNF -1480C/G point mutation BDNF 1 (0/1/0) NO NO
IL6 174G/C point mutation IL6 1 (0/1/0) NO NO
SSTR5 G573A point mutation SSTR5 1 (1/0/0) NO NO
rs63470962 insertion GRM7 1 (0/1/0) NO NO
IMPA2 159T>C point mutation IMPA2 1 (1/0/0) NO NO
SSTR5 T-2187G point mutation SSTR5 1 (0/1/0) NO NO
rs113329024 insertion CACNA1C 1 (0/1/0) NO NO
BDNF 3071G/A point mutation BDNF 1 (0/1/0) NO NO
SSTR5 T-461C point mutation SSTR5 1 (0/1/0) NO NO
MIR137/MIR2682 Chr1:98515539 A/T point mutation Enhancer MIR137, MIR2682 1 (1/0/0) YES NO
BDNF -633T/A point mutation BDNF 1 (1/0/0) NO NO
SLC1A2 Chr1:35441380 G/C point mutation Putative promoter SLC1A2 1 (0/1/0) NO NO
BDNF 9202G/A point mutation BDNF 1 (0/1/0) NO NO
IMPA2 230+141G>A point mutation IMPA2 1 (0/1/0) NO NO
SYNGR1 exon3 Ser97Ser point mutation exon3 SYNGR1 1 (1/0/0) YES NO
SLC1A2 Chr1:35440927 A/G point mutation 5'-UTR SLC1A2 1 (0/1/0) NO NO
BDNF A-633T point mutation BDNF 1 (0/1/0) NO NO
IMPA2 -241 -237dup duplication IMPA2 1 (0/1/0) NO NO
SYNGR1 exon6 Asn(ins/del) insertion/deletion exon6 SYNGR1 1 (0/1/0) YES NO
SLC1A2 Chr1:35440635 G/A point mutation 5'-UTR SLC1A2 1 (0/1/0) NO NO
BDNF C270T point mutation BDNF 1 (0/1/0) NO NO
IMPA2 382-44G>A point mutation IMPA2 1 (0/1/0) NO NO
SYNJ1 intron12 IVS12+15delT,+17delT insertion/deletion intron12 SYNJ1 1 (0/1/0) NO NO
SLC1A2 Chr1:35440563 C/G point mutation 5'-UTR SLC1A2 1 (0/1/0) NO NO
BDNF (CA) microsatellite 1.3 kb away from rs6265 BDNF 1 (0/1/0) NO NO
SYNJ1 IVS12+15delT,+17delT insertion/deletion SYNJ1 1 (0/1/0) NO NO
SLC1A2 Chr1:35344202 G/T point mutation Exonic p.(A20S) 5'-UTR SLC1A2 1 (0/1/0) YES NO
BDNF g.11757C>G point mutation BDNF 1 (0/1/0) NO NO
SYNJ1 IVS28-7G/T point mutation SYNJ1 1 (0/1/0) NO NO
SLC1A2 Chr1:35339061 C/T point mutation Exonic p.(A7V) SLC1A2 1 (0/1/0) YES NO
IMPA2 490+13 14insA insertion/deletion IMPA2 1 (0/1/0) NO NO
SYNJ1 IVS29+14C/T point mutation SYNJ1 1 (0/1/0) NO NO
SLC1A2 Chr1:35282452 C/T point mutation Exonic p.(R572C) SLC1A2 1 (0/1/0) YES NO
BDNF hCV11592756 point mutation BDNF 1 (1/0/0) NO NO
IMPA2 599+97G>A point mutation IMPA2 1 (0/1/0) NO NO
SYNJ1 K295R point mutation SYNJ1 1 (0/1/0) NO NO
SLC1A2 Chr1:35279202 A/G point mutation 3'-UTR SLC1A2 1 (0/1/0) NO NO
IMPA2 599+99G>A point mutation IMPA2 1 (0/1/0) NO NO
TBP CAG/CAA repeats microsatellite TBP 1 (0/1/0) NO NO
IL1B Chr2:113304498 Exonic IL1B 1 (0/0/1) NO NO
IMPA2 -708G>A point mutation IMPA2 1 (0/1/0) YES NO
TBX1 v14186 point mutation TBX1 1 (0/1/0) YES YES
IL36RN Chr2:113536607 Exonic IL36RN 1 (0/0/1) NO NO
C21ORF2 insertion/deletion 21q23 1 (0/1/0) NO NO
TCF4 CAG/CTG repeat microsatellite TCF4 1 (0/1/0) NO NO
IL1RN Chr2:113594121 Intronic, Exonic IL1RN 1 (0/0/1) NO NO
CAP2 triplet repeat microsatellite CAP2 1 (0/1/0) NO NO
IMPA2 IVS1-15G>A point mutation IMPA2 1 (0/1/0) YES NO
ACTR3 Chr2:114401422 Exonic ACTR3 1 (0/0/1) NO NO
CCK STR microsatellite CCK 1 (0/1/0) NO YES
IMPA2 IVS5+13-14InsA insertion/deletion IMPA2 1 (0/1/0) YES NO
TH 1-5 allele others TH 1 (0/1/0) NO YES
DPP10 Chr2:116251310 Exonic DPP10 1 (0/0/1) NO NO
CD18-AciI microsatellite 21q22.3 1 (0/1/0) NO NO
INPP1 C973A point mutation INPP1 1 (0/1/0) NO NO
DPP10 Chr2:116314867 Exonic DPP10 1 (0/0/1) NO NO
CHRFAM7A 2bp deletion insertion/deletion CHRFAM7A 1 (0/1/0) YES NO
INS PvuII Polymorphism SNP INS 1 (0/1/0) NO NO
TH BglII RFLP TH 1 (1/0/0) NO NO
PTPN4 Chr2:120419158 Exonic PTPN4 1 (0/0/1) NO NO
CHRNA7 -86C/T point mutation CHRNA7 1 (0/1/0) NO NO
iPLA2 C/T point mutation PLA2G6 1 (0/1/0) NO NO
TH (CATT)n duplication TH 1 (1/0/0) NO NO
GLI2 Chr2:121444612 Exonic GLI2 1 (0/0/1) NO NO
COL6A1 VNTR 21q23 1 (0/1/0) NO NO
KAT5 BanI polymorphism point mutation KAT5 1 (0/1/0) NO YES
TH intron 1 tetranucleotide polymorphism others intron 1 TH 1 (0/1/0) NO NO
GLI2 Chr2:121464518 Exonic GLI2 1 (0/0/1) NO NO
COMT C256G SNP COMT 1 (0/1/0) NO NO
KCNN3 CAG/CTG repeat microsatellite 1q21.3 KCNN3 1 (0/1/0) NO NO
ZHX1 Chr8:124336277 Intronic, Exonic, ncRNA ZHX1-C8orf76, ZHX1 1 (0/0/1) NO NO
COMT Codon108/158 point mutation COMT 1 (0/1/0) NO NO
ZHX1 Chr8:124336599 Intronic, Exonic, ncRNA ZHX1-C8orf76, ZHX1 1 (0/0/1) NO NO
COMT G/A point mutation COMT 1 (1/0/0) NO YES
KCNQ2 3'end 30-15/54 point mutation 3'end KCNQ2 1 (0/1/0) NO NO
ATAD2 Chr8:124419211 Exonic ATAD2 1 (0/0/1) NO NO
KCNQ2 3'end 30-84/37 point mutation 3'end KCNQ2 1 (0/1/0) NO NO
ATAD2 Chr8:124440660 Exonic ATAD2 1 (0/0/1) NO NO
COMT NlaIII point mutation COMT 1 (1/0/0) NO NO
KCNQ2 5'end 4/30/1958 point mutation 5'end KCNQ2 1 (0/1/0) NO NO
TH (TCAT)n microsatellite TH 1 (0/1/0) YES NO
ATAD2 Chr8:124451340 Exonic ATAD2 1 (0/0/1) NO NO
COMT P2 promoter -278A/G point mutation P2 promoter COMT 1 (0/1/0) NO NO
KCNQ2 Intron12 7/30/1930 point mutation Intron12 KCNQ2 1 (1/0/0) NO NO
TH tetranucleotide repeat tetranucleotide repeat TH 1 (0/1/0) NO NO
FBXO32 Chr8:124614644 Exonic FBXO32 1 (0/0/1) NO NO
KCNQ2 Intron 30-2/62 point mutation Intron KCNQ2 1 (1/0/0) NO NO
TH VNTR VNTR TH 1 (0/1/0) NO NO
TRIB1 Chr8:126514759 Exonic TRIB1 1 (0/0/1) NO NO
cPLA2 BanI dimorphic site point mutation KAT5 1 (0/1/0) NO NO
KCNQ2 Intron4 30-17/37 point mutation Intron4 KCNQ2 1 (0/1/0) NO NO
ATP6V0A2 TJ6 GC24E19A point mutation ATP6V0A2 1 (0/1/0) NO NO
MYC Chr8:128819709 Exonic MYC 1 (0/0/1) NO NO
CRH polymorphisms VNTR CRH 1 (0/1/0) NO NO
KIAA1595 GC29E04A point mutation DDX55 1 (0/1/0) NO NO
TMEM1 microsatellite microsatellite 21q22.3 TRAPPC10 1 (0/1/0) NO NO
DYNC1H1 Chr14:101530331 Exonic DYNC1H1 1 (0/0/1) NO NO
CRHR2 1047G/A point mutation CRHR2 1 (0/1/0) NO YES
KIAA1595 GC29E06A point mutation DDX55 1 (1/0/0) NO NO
TNF-alpha 308G/A point mutation TNF 1 (1/0/0) NO NO
DYNC1H1 Chr14:101533297 Exonic DYNC1H1 1 (0/0/1) NO NO
CRHR2 intron10 (GAT)n microsatellite intron10 CRHR2 1 (1/0/0) NO NO
KIAA1595 GC29E08A point mutation DDX55 1 (0/1/0) NO NO
HSP90AA1 Chr14:101622401 Exonic HSP90AA1 1 (0/0/1) NO NO
CRHR2 intron10 (GT)n microsatellite intron10 CRHR2 1 (0/1/0) NO NO
KNTC1 GC07E08A point mutation KNTC1 1 (0/1/0) NO NO
TPH1 3'UTR A27237G point mutation 3'UTR TPH1 1 (0/1/0) NO NO
RCOR1 Chr14:102250649 Exonic RCOR1 1 (0/0/1) NO NO
CRHR2 intron4 (CA)n microsatellite intron4 CRHR2 1 (0/1/0) NO NO
KNTC1 GC07E25A point mutation KNTC1 1 (0/1/0) NO NO
TPH1 5'flanking A-1067G point mutation 5'flanking TPH1 1 (0/1/0) NO NO
MARK3 Chr14:102985013 Exonic MARK3 1 (0/0/1) NO NO
CUX2 1191C/T point mutation CUX2 1 (0/1/0) NO NO
KNTC1 GC07E57A point mutation KNTC1 1 (0/1/0) NO NO
TPH1 5'flanking G-347T point mutation 5'flanking TPH1 1 (0/1/0) NO NO
MARK3 Chr14:103002170 Exonic MARK3 1 (0/0/1) NO NO
CUX2 2607G/C point mutation CUX2 1 (0/1/0) NO NO
LEPR hcv518168 point mutation LEPR 1 (1/0/0) NO NO
TPH1 5'flanking T-1721G point mutation 5'flanking TPH1 1 (0/1/0) NO NO
KLC1 Chr14:103193796 Exonic KLC1 1 (0/0/1) NO NO
CUX2 277G/A point mutation CUX2 1 (0/1/0) NO NO
LNX1 SNP A-1948953 point mutation LNX1 1 (1/0/0) NO NO
KLC1 Chr14:103193859 Exonic KLC1 1 (0/0/1) NO NO
CUX2 3732T/C point mutation CUX2 1 (0/1/0) NO NO
LOC100507206 1634tet microsatellite LOC100507206 1 (1/0/0) NO NO
TDRD9 Chr14:103464808 Exonic TDRD9 1 (0/0/1) NO NO
D18S453 microsatellite 18p11.2 1 (1/0/0) YES NO
LOC100507206 29818-insT point mutation LOC100507206 1 (1/0/0) NO NO
TPH1 promoter 218A/C point mutation promoter TPH1 1 (0/1/0) NO NO
TDRD9 Chr14:103576402 Exonic TDRD9 1 (0/0/1) NO NO
D1 EcoR1 SNP DRD1 1 (0/1/0) NO NO
LOC100507206 307CA1 microsatellite LOC100507206 1 (1/0/0) NO NO
TPH2 C2755A point mutation TPH2 1 (1/0/0) NO NO
BRF1 Chr14:104763646 Exonic BRF1 1 (0/0/1) NO NO
D1S243 microsatellite PRKCZ 1 (1/0/0) NO NO
LOC100507206 307CA2 microsatellite LOC100507206 1 (1/0/0) NO NO
TPH2 promoter 703G/T point mutation promoter TPH2 1 (0/1/0) NO NO
PACS2 Chr14:104904668 Exonic PACS2 1 (0/0/1) NO NO
D1 Taq1 SNP DRD1 1 (0/1/0) NO NO
LOC100507206 307GT4 microsatellite LOC100507206 1 (1/0/0) NO NO
TPH1 BfaI Polymorphism SNP TPH1 1 (0/1/0) NO NO
MTA1 Chr14:105007547 Exonic, 3'UTR MTA1 1 (0/0/1) NO NO
D21S1260 microsatellite 21q22.3 1 (1/0/0) NO NO
LOC100507206 D12S1634 microsatellite LOC100507206 1 (1/0/0) NO NO
TRPM2 c.2363C>T point mutation exon15 TRPM2 1 (0/1/0) NO NO
NDE1 Chr16:15785033 C/G missense Exon 7 NDE1 1 (0/1/0) YES NO
D21s1411 microsatellite 21q22.3 1 (0/1/0) NO NO
LOC100507206 D12S2075 microsatellite LOC100507206 1 (1/0/0) NO NO
TRPM2 c.2890+55A>G point mutation intron18 TRPM2 1 (0/1/0) NO NO
NDE1 Chr16:15785118 C/T missense Exon 7 NDE1 1 (0/1/0) YES NO
D21S171 microsatellite 21q22.3 1 (1/0/0) NO NO
LOC100507206 D12S307 microsatellite LOC100507206 1 (1/0/0) NO NO
TRPM2 c.3205C>T point mutation exon20 TRPM2 1 (0/1/0) NO NO
NDE1 Chr16:15785177 C/T missense Exon 7 NDE1 1 (1/0/0) YES NO
D21S1897 microsatellite 21q22.3 1 (0/1/0) NO NO
LOC100507206 D12SDK1 microsatellite LOC100507206 1 (1/0/0) NO NO
TRPM2 c.3246+68C>T point mutation intron20 TRPM2 1 (0/1/0) NO NO
NOS1 Exon 1c A/G point mutation Exon 1c NOS1 1 (0/1/0) NO NO
D21S1903 microsatellite 21q22.3 1 (0/1/0) NO NO
LOC100507206 pufu-in/del point mutation LOC100507206 1 (1/0/0) NO NO
TSPO exon4 Ala147Thr point mutation exon4 TSPO 1 (0/1/0) NO YES
NOS1 Exon 1f L/S Exon 1f NOS1 1 (0/1/0) NO NO
D21S212 microsatellite 21q22.3 1 (0/1/0) NO NO
MAB21L1 CAG/CTG repeat microsatellite MAB21L1 1 (0/1/0) NO NO
TSPO exon4 His162Arg point mutation exon4 TSPO 1 (0/1/0) NO YES
NOS3 Intron 4 VNTR 4a/b VNTR Intron NOS3 1 (0/1/0) NO NO
D21S266 microsatellite 21q22.3 1 (0/1/0) NO NO
MAOA 1-8 allele others MAOA 1 (0/1/0) NO NO
TYR (GA)n - (CA)n duplication TYR 1 (0/1/0) NO NO
MUC4 Chr3:195492191 C/A missense Exon MUC4 1 (0/1/0) NO NO
D22S1169 microsatellite 1 (1/0/0) YES NO
MAOA A1609G point mutation MAOA 1 (0/1/0) YES YES
uMAOA duplication promoter MAOA 1 (0/1/0) NO YES
GDNF Chr5:37812784 T/A point mutation 3'UTR GDNF 1 (0/1/0) NO NO
D22S279 microsatellite 1 (1/0/0) YES NO
VAMP2 C 25610873 10 point mutation VAMP2 1 (1/0/0) NO NO
GDNF Chr5:37812782 T/A point mutation 3'UTR GDNF 1 (0/1/0) NO NO
D22S922 microsatellite 1 (0/1/0) YES NO
MAOA exon 8 Fnu4HI Polymorphism SNP exon 8 MAOA 1 (0/1/0) NO NO
WFS1 A134A point mutation exon4 WFS1 1 (0/1/0) NO NO
GDNF Chr5:37814769 G/A point mutation 3'UTR GDNF 1 (0/1/0) NO NO
D2 Taq1 SNP DRD2 1 (0/1/0) NO NO
MAOA exon 8 RFLP SNP MAOA 1 (0/1/0) NO YES
WFS1 E737K point mutation exon8 WFS1 1 (0/1/0) NO NO
CYTH4 Promoter (GTTT)n STR Promoter CYTH4 1 (1/0/0) NO NO
D3 Msc1 SNP DRD3 1 (0/1/0) NO NO
MAOA exon 8 VNTR VNTR MAOA 1 (0/1/0) NO YES
WFS1 exon8 A1832G point mutation exon8 WFS1 1 (0/1/0) NO NO
MAOA CA point mutation MAOA 1 (1/0/0) NO NO
D5S392 microsatellite SLC6A3 1 (0/0/1) NO NO
MAOA Fnu4HI Polymorphism SNP MAOA 1 (1/0/0) NO NO
5-HT2C Cys/Ser point mutation HTR2C 1 (0/1/0) NO NO
DAOA 3'UTR SNP12 point mutation 3'UTR DAOA 1 (1/0/0) YES NO
MAOA-Fnu point mutation MAOA 1 (0/1/0) NO YES
COMT G1947A point mutation COMT 1 (0/1/0) NO YES
DAOA M12 point mutation DAOA 1 (0/1/0) YES NO
MAOA intron 1 VNTR VNTR intron 1 MAOA 1 (0/1/0) NO NO
WFS1 I720V point mutation exon8 WFS1 1 (0/1/0) NO NO
COMT C1886G point mutation COMT 1 (1/0/0) NO YES
DAOA M23 point mutation DAOA 1 (1/0/0) YES NO
MAOA intron 2 dinucleotide repeat duplication intron 2 MAOA 1 (0/1/0) NO NO
WFS1 I823I point mutation exon8 WFS1 1 (0/1/0) NO NO
DAOA M24 point mutation DAOA 1 (0/1/0) YES NO
MAOA LPR VNTR MAOA 1 (0/1/0) YES YES
WFS1 K811K point mutation exon8 WFS1 1 (0/1/0) NO NO
DAOA z6:1117 point mutation DAOA 1 (0/1/0) NO NO
WFS1 N500N point mutation exon8 WFS1 1 (0/1/0) NO NO
DAO MDAAO4 point mutation DAO 1 (0/1/0) YES NO
WFS1 R456H point mutation exon8 WFS1 1 (0/1/0) NO NO
DAO MDAAO5 point mutation DAO 1 (0/1/0) YES NO
WFS1 S855S point mutation exon8 WFS1 1 (0/1/0) NO NO
DAO MDAAO6 point mutation DAO 1 (0/1/0) YES NO
WFS1 SNP1023 point mutation WFS1 1 (0/1/0) NO YES
WFS1 SNP1185 point mutation WFS1 1 (0/1/0) NO YES
DAT E15+1812T/C point mutation SLC6A3 1 (0/1/0) NO NO
MAOB 1-12 allele others MAOB 1 (1/0/0) NO NO
WFS1 SNP1645 point mutation WFS1 1 (0/1/0) NO YES
DAT E15+274G/C point mutation SLC6A3 1 (0/1/0) NO NO
WFS1 SNP1832 point mutation WFS1 1 (0/1/0) NO YES
DAT E15+352G/A point mutation SLC6A3 1 (0/1/0) NO NO
MCP-1 A-2518G point mutation CCL2 1 (0/1/0) NO NO
WFS1 SNP2206 point mutation WFS1 1 (0/1/0) NO YES
DAT I10+117G/A point mutation SLC6A3 1 (0/1/0) NO NO
MDR1 exon26 C3435T point mutation exon 26 ABCB1 1 (1/0/0) NO NO
WFS1 SNP2565 point mutation WFS1 1 (0/1/0) NO YES
DAT I6+96G/C point mutation SLC6A3 1 (0/1/0) NO NO
MED12 exon42 duplication duplication exon42 MED12 1 (0/1/0) YES NO
WFS1 SNP684 point mutation WFS1 1 (1/0/0) NO YES
DAT I9-21G/A point mutation SLC6A3 1 (0/1/0) NO NO
MMP3 1171 5A/6A insertion/deletion MMP3 1 (0/1/0) YES NO
WFS1 SNP935 point mutation WFS1 1 (0/1/0) NO YES
DAT P+214A/G point mutation SLC6A3 1 (0/1/0) NO NO
mtDNA 12358A>G point mutation mtDNA 1 (1/0/0) NO NO
WFS1 V395V point mutation exon8 WFS1 1 (0/1/0) NO NO
mtDNA 3644T>C point mutation mtDNA 1 (1/0/0) NO NO
WFS1 V503G point mutation exon8 WFS1 1 (0/1/0) NO NO
DBH A304S point mutation DBH 1 (0/1/0) NO NO
mtDNA 5460G>A point mutation mtDNA 1 (0/1/0) NO NO
White PolyT microsatellite 21q22.3 1 (0/1/0) NO NO
uVNTR MAOA MAOA 1 (0/1/0) NO NO
rs1137070 c.1460 C/T c.1460 in MAOA exon 14 MAOA 1 (1/0/0) NO NO
mtDNA A9115G point mutation mtDNA 1 (0/1/0) NO NO
YWHAH 5'UTR (GCCTGCA)n duplication 5'UTR YWHAH 1 (1/0/0) NO NO
MAOA-CA MAOA in intron 2 of MAOA MAOA 1 (1/0/0) NO NO
DDC microsatellite polymorphisms microsatellite DDC 1 (0/1/0) NO NO
ANK3 exon 48 P1489S point mutation exon 48 ANK3 1 (0/1/0) NO NO
MAOA-VNTR MAOA in intron 1 of MAOA MAOA 1 (0/1/0) NO NO
DISC1 1013 G>A point mutation DISC1 1 (0/0/1) NO NO
mtDNA D-loop C195T point mutation mtDNA_D-loop 1 (1/0/0) NO NO
ANK3 exon 48 T1861M point mutation exon 48 ANK3 1 (0/1/0) NO NO
rs1799835 c.941 T/G c.941 in MAOA exon 8 MAOA 1 (0/1/0) NO NO
DISC1 1253 G>A point mutation DISC1 1 (0/0/1) NO NO
mtDNA D-loop G16300A point mutation mtDNA_D-loop 1 (1/0/0) NO NO
ANK3 exon 48 E1926D point mutation exon 48 ANK3 1 (0/1/0) NO NO
rs58575285 GRIK4 1 (1/0/0) NO NO
DISC1 1700 G>A point mutation DISC1 1 (0/0/1) NO NO
mtDNA D-loop T114C point mutation mtDNA_D-loop 1 (1/0/0) NO NO
ANK3 exon 48 S2043N point mutation exon 48 ANK3 1 (0/1/0) NO NO
rs66554220 HLA-G 1 (1/0/0) NO NO
DISC1 -215(TG)8-13 others 5' upstream DISC1 1 (0/1/0) NO YES
mtDNA ND4L T10652C point mutation mtDNA_ND4L 1 (1/0/0) NO YES
ANK3 exon 48 I2158T point mutation exon 48 ANK3 1 (0/1/0) NO NO
rs458178 1 (0/1/0) NO NO
DISC1 2261 C>G point mutation DISC1 1 (0/0/1) NO NO
mtDNA T3394C point mutation mtDNA 1 (0/1/0) NO NO
ANK3 exon 48 D2319N point mutation exon 48 ANK3 1 (0/1/0) NO NO
rs3045444 ANK3 1 (0/1/0) NO NO
DISC1 2425 TCATdel insertion/deletion DISC1 1 (0/0/1) NO NO
MTHFD G1958A point mutation MTHFD1 1 (1/0/0) YES NO
ANK3 exon 48 F2375V point mutation exon 48 ANK3 1 (0/1/0) NO NO
rs10064525 SLC6A3 1 (0/1/0) NO NO
DISC1 627 C>G point mutation DISC1 1 (0/0/1) NO NO
ANK3 exon 48 S2409P point mutation exon 48 ANK3 1 (0/1/0) NO NO
rs2550240 MUC4 1 (0/1/0) NO NO
DISC1 74 G>A point mutation DISC1 1 (0/0/1) NO NO
ANK3 exon 48 N2643S point mutation exon 48 ANK3 1 (0/1/0) NO NO
rs13232194 NAPEPLD 1 (0/1/0) NO NO
DISC1 790 C>T point mutation DISC1 1 (0/0/1) NO NO
MTR A2756G point mutation MTR 1 (1/0/0) YES NO
ANK3 exon 48 R2719T point mutation exon 48 ANK3 1 (0/1/0) NO NO
DISC1 887 A>G point mutation DISC1 1 (0/0/1) NO NO
NCAM1 2208T>G point mutation NCAM1 1 (0/1/0) NO YES
ANK3 exon 48 G2845E point mutation exon 48 ANK3 1 (0/1/0) NO NO
DISC1 A844G point mutation DISC1 1 (0/1/0) YES NO
NCAM1 2256 2257 insATGG point mutation NCAM1 1 (0/1/0) NO YES
ANK3 exon 48 S2858L point mutation exon 48 ANK3 1 (0/1/0) NO NO
DISC1 C1460T point mutation DISC1 1 (0/1/0) YES NO
NCAM1 I621G>T point mutation NCAM1 1 (0/1/0) NO YES
ANK3 exon 48 Q3264K point mutation exon 48 ANK3 1 (0/1/0) NO NO
DISC1 exon2 Pro/Leu point mutation exon2 DISC1 1 (0/1/0) NO NO
NCAM1 IVS0-49de IG point mutation NCAM1 1 (0/1/0) NO YES
ANK3 exon 48 S3521G point mutation exon 48 ANK3 1 (0/1/0) NO NO
DISC1 G65049 microsatellite DISC1 1 (0/1/0) YES NO
NCAM1 IVS4+80G>C point mutation NCAM1 1 (0/1/0) NO YES
ANK3 exon 48 E3563G point mutation exon 48 ANK3 1 (0/1/0) NO NO
DISC1 IVS1+3 A>T point mutation DISC1 1 (0/0/1) NO NO
NCAM1 IVS6+32T>C point mutation NCAM1 1 (1/0/0) NO YES
ANK3 exon 48 S3697C point mutation exon 48 ANK3 1 (0/1/0) NO NO
DISC1 T11840C point mutation DISC1 1 (0/1/0) YES NO
NCAM1 IVS7+155G>T point mutation NCAM1 1 (0/1/0) NO YES
ANK3 exon 48 N3789S point mutation exon 48 ANK3 1 (0/1/0) NO NO
DISC1 T2163A point mutation DISC1 1 (0/1/0) YES NO
NCOR2 GC34E20A duplication NCOR2 1 (0/1/0) NO NO
ANK3 exon 48 K3942R point mutation exon 48 ANK3 1 (0/1/0) NO NO
DOCK9 (AAGTA) indel insertion/deletion DOCK9 1 (1/0/0) NO NO
NDUFV2 -1020G>T point mutation NDUFV2 1 (0/1/0) NO NO
DRD2/ANKK1 Taq-IA point mutation DRD2 1 (0/1/0) NO NO
DNAH14 Chr1:225586971 A/T Stoploss Chr1:225586971 DNAH14 1 (0/0/1) NO NO
NDUFV2 -2694A>G point mutation NDUFV2 1 (1/0/0) NO NO
ARV1 Chr1:231114915 A/T Missense Chr1:231114915 ARV1 1 (0/0/1) NO NO
NDUFV2 -3041T>G point mutation NDUFV2 1 (1/0/0) NO NO
SLK Chr10:105779646 C/T Missense Chr10:105779646 SLK 1 (0/0/1) NO NO
DRD1 EcoRI Polymorphism SNP DRD1 1 (0/1/0) NO NO
NDUFV2 -3245T>C point mutation NDUFV2 1 (1/0/0) NO NO
CFAP46 Chr10:134730168 G/A Missense Chr10:134730168 CFAP46 1 (0/0/1) NO NO
DRD1 RFLP SNP DRD1 1 (0/1/0) NO NO
NDUFV2 -3542G>A point mutation NDUFV2 1 (1/0/0) NO NO
CARD16 Chr11:104916205 A/G Upstream Chr11:104916205 CARD16 1 (0/0/1) NO NO
DRD2 -141CIns/Del insertion/deletion DRD2 1 (0/1/0) NO YES
ZPR1 Chr11:116652892 A/T Missense Chr11:116652892 ZNF259 1 (0/0/1) NO NO
SLU7 Chr5:159840980 T/C Missense Chr5:159840980 SLU7 1 (0/0/1) NO NO
DRD2 -151ins/del insertion/deletion DRD2 1 (0/1/0) NO NO
WWC1 Chr5:167896045 G/A others Chr5:167896045 WWC1 1 (0/0/1) NO NO
DRD2 5'flanking -141C Ins/Del insertion/deletion 5'flanking DRD2 1 (0/1/0) YES NO
SLC6A2 Gly478Ser point mutation SLC6A2 1 (0/1/0) YES NO
TAB2 Chr6:149699617 G/A Missense Chr6:149699617 TAB2 1 (0/0/1) NO NO
DRD2 (CA)n duplication DRD2 1 (0/1/0) NO NO
SLC6A2 TaqI polymorphism SNP SLC6A2 1 (0/1/0) NO NO
MTOR Chr1:11194520 C/T Splicing Chr1:11194520 MTOR 1 (0/0/1) NO NO
DRD2 intron 1 (TG)n duplication intron1 DRD2 1 (0/1/0) NO NO
SLC6A2 Thr99Ile point mutation SLC6A2 1 (0/1/0) YES NO
CASP1 Chr11:104901923 Nonframeshift del Chr11:104901923 CASP1 1 (0/0/1) NO NO
DRD2 microsatellite microsatellite DRD2 1 (1/0/0) NO YES
SLC6A2 Val245Ile point mutation SLC6A2 1 (0/1/0) YES NO
SLC25A21 Chr14:37147560 C/T others Chr14:37147560 SLC25A21 1 (0/0/1) NO NO
DRD2 polymorphism others DRD2 1 (0/1/0) NO NO
SLC6A2 Val449Ile point mutation SLC6A2 1 (0/1/0) YES NO
ID1 Chr20:30193296 T/G Missense Chr20:30193296 ID1 1 (0/0/1) NO NO
SLC6A2 Val69Ile point mutation SLC6A2 1 (0/1/0) YES NO
CDV3 Chr3:133305557 A/T Missense Chr3:133305557 CDV3 1 (0/0/1) NO NO
PITPNM2 GC18E01A point mutation PITPNM2 1 (0/1/0) NO NO
ODZ2 Chr5:167627125 C/T Missense Chr5:167627125 TENM2 1 (0/0/1) NO NO
RTN4 3'UTR CAA insertion insertion/deletion 3'UTR RTN4 1 (0/1/0) YES NO
GRN C/T point mutation GRN 1 (1/0/0) YES NO
NOS1 exon13 SNP2 point mutation exon13 NOS1 1 (0/0/1) YES NO
NOV Chr8:120430415 G/A missense point mutation Chr8:120430415 NOV 1 (0/0/1) NO NO
DRD2 (TG)n duplication DRD2 1 (1/0/0) NO NO
NOS1 exon15 IVS15+38C/T point mutation exon15 NOS1 1 (0/0/1) YES NO
INSL6 Chr9:5164252 C/T missense point mutation Chr9:5164252 INSL6 1 (0/0/1) NO NO
DRD3 allele1/allele2 others DRD3 1 (0/1/0) NO NO
NOS1 exon16 2607C/T point mutation exon16 NOS1 1 (0/0/1) YES NO
LOC285033 Chr2:96907615 A/C missense point mutation Chr2:96907615 LOC285033 1 (0/0/1) NO NO
NOS1 exon17 2712C/T point mutation exon17 NOS1 1 (0/0/1) YES NO
NCEH1 Chr3:172365793 C/T missense point mutation Chr3:172365793 NCEH1 1 (0/0/1) NO NO
DRD3 exon1 D3 polymorphism others exon1 DRD3 1 (0/1/0) NO NO
NOS1 exon17 IVS17+15A/G point mutation exon17 NOS1 1 (0/0/1) YES NO
ZAN Chr7:100382373 C/T point mutation Chr7:100382373 ZAN 1 (0/0/1) NO NO
NOS1 exon18 SNP3 point mutation exon18 NOS1 1 (0/0/1) YES NO
FAM38B Chr18:10759858 T/C point mutation Chr18:10759858 PIEZO2 1 (0/0/1) NO NO
DRD4 2-10 allele others DRD4 1 (0/1/0) NO YES
NOS1 exon19 IVS19+13T/G point mutation exon19 NOS1 1 (0/0/1) YES NO
FAM83F rs3021268 single nucleotide variation rs3021268 doesn't map to any assembly. FAM83F 1 (0/1/0) NO NO
DRD4 48bp repeat duplication DRD4 1 (0/1/0) NO NO
NOS1 exon20 137244A/G point mutation exon20 NOS1 1 (0/0/1) YES NO
ANK3 Chr10:61786761 A/G point mutation ANK3 1 (0/1/0) NO NO
NOS1 exon21 3258C/T point mutation exon21 NOS1 1 (0/0/1) YES NO
ANK3 Chr10:61787065 TA/- insertion/deletion ANK3 1 (0/1/0) NO NO
NOS1 exon27 4063G/A point mutation exon27 NOS1 1 (0/0/1) YES NO
ANK3 Chr10:61788626 G/T point mutation 3'UTR ANK3 1 (0/1/0) NO NO
DRD4 HincII Polymorphism SNP DRD4 1 (0/1/0) NO NO
NOS1 exon27 4065G/A point mutation exon27 NOS1 1 (0/0/1) YES NO
ANK3 Chr10:61789498 AC/- insertion/deletion ANK3 1 (0/1/0) NO NO
DRD5 (CT/GT/GA)n duplication DRD5 1 (0/1/0) NO NO
NOS1 exon27 4154G/A point mutation exon27 NOS1 1 (0/0/1) YES NO
ANK3 Chr10:61789512 C/- insertion/deletion ANK3 1 (0/1/0) NO NO
DRD5 D4S615 microsatellite DRD5 1 (0/1/0) YES YES
NOS1 exon27 IVS27+14T/G point mutation exon27 NOS1 1 (0/0/1) YES NO
ANK3 Chr10:61789556 C/- insertion/deletion ANK3 1 (0/1/0) NO NO
G'>DRP2 5'-flanking -975C>G point mutation 5'flanking DRP2 1 (0/1/0) NO NO
NOS1 exon27 IVS27+9C/A point mutation exon27 NOS1 1 (0/0/1) YES NO
ANK3 Chr10:61819783 T/G point mutation ANK3 1 (0/1/0) NO NO
DRP2 exon13 1506T>C point mutation exon13 DRP2 1 (0/1/0) NO NO
NOS1 exon27 SNP5 point mutation exon27 NOS1 1 (0/0/1) YES NO
ANK3 Chr10:61841574 T/- insertion/deletion ANK3 1 (0/1/0) NO NO
DRP2 exon14 *2236T>C point mutation exon14 DRP2 1 (0/1/0) NO NO
NOS1 exon29 SNP4 point mutation exon29 NOS1 1 (0/0/1) YES NO
ANK3 Chr10:61843365 C/G point mutation ANK3 1 (0/1/0) NO NO
DRP2 exon4 352G>A point mutation exon4 DRP2 1 (0/1/0) NO NO
NOS1 exon7 IVS7-15C/G point mutation exon7 NOS1 1 (0/0/1) YES NO
ANK3 Chr10:61900256 G/A point mutation ANK3 1 (0/1/0) NO NO
DRP2 exon4 426C>T point mutation exon4 DRP2 1 (0/1/0) NO NO
ANK3 Chr10:61900727 G/C point mutation ANK3 1 (0/1/0) NO NO
DUSP6 exon1 Leu111Val point mutation exon1 DUSP6 1 (0/1/0) NO YES
NOS1 SNP1 point mutation NOS1 1 (0/1/0) YES NO
ANK3 Chr10:61900857 G/A point mutation ANK3 1 (0/1/0) NO NO
DUSP6 Leu114Val point mutation DUSP6 1 (0/1/0) NO YES
NOS3 G894T point mutation NOS3 1 (0/1/0) NO YES
ANK3 Chr10:61901317 -/TG insertion/deletion ANK3 1 (0/1/0) NO NO
ERBB4 SNV7 G>A point mutation ERBB4 1 (1/0/0) NO NO
NOS3 Intron4 VNTR VNTR Intron4 NOS3 1 (0/1/0) NO YES
ANK3 Chr10:61901321 T/G point mutation ANK3 1 (0/1/0) NO NO
ERBB4 SNV8 A insertion/deletion insertion/deletion ERBB4 1 (0/1/0) NO NO
NOS3 T-786C point mutation NOS3 1 (0/1/0) NO YES
ANK3 Chr10:61941143 C/G point mutation ANK3 1 (0/1/0) NO NO
ERDA1 CAG/CTG repeat microsatellite ERDA1 1 (0/1/0) NO NO
ANK3 Chr10:61958307 G/T point mutation ANK3 1 (0/1/0) NO NO
NOTCH4 promoter A>G point mutation promoter NOTCH4 1 (0/1/0) NO NO
ANK3 Chr10:62149642 C/T point mutation ANK3 1 (0/1/0) NO NO
FEZ1 IVS3+2509C>T point mutation FEZ1 1 (0/1/0) YES NO
NQO1 C609T point mutation NQO1 1 (0/1/0) NO YES
ANK3 Chr10:62150190 G/A point mutation ANK3 1 (0/1/0) NO NO
FEZ1 IVS4+1077T>C point mutation FEZ1 1 (0/1/0) YES NO
NR2E1 g. -1429 point mutation NR2E1 1 (0/1/0) YES NO
ANK3 Chr10:62332894 -/A insertion/deletion ANK3 1 (0/1/0) NO NO
FEZ1 IVS9+66A>T point mutation FEZ1 1 (0/1/0) YES NO
ANK3 Chr10:62332895 A/AA duplication ANK3 1 (0/1/0) NO NO
FLJ11021 GC6E04A point mutation RSRC2 1 (0/1/0) NO NO
ANK3 Chr10:62332985 T/- insertion/deletion ANK3 1 (0/1/0) NO NO
FLJ22471 GC32E03A point mutation CCDC92 1 (0/1/0) NO NO
NRG1 D8S1810 microsatellite NRG1 1 (1/0/0) NO NO
ANK3 Chr10:62333120 ACCAACCA/- insertion/deletion ANK3 1 (0/1/0) NO NO
FLJ22471 GC32E04A point mutation CCDC92 1 (1/0/0) NO NO
NRG1 exon 11 Val>Leu point mutation exon 11 1 (0/1/0) YES NO
ANK3 Chr10:62493812 G/C point mutation ANK3 1 (0/1/0) NO NO
GABRA1 -181A/G point mutation GABRA1 1 (0/1/0) NO YES
NRG1 SNP88NR221533 point mutation NRG1 1 (0/1/0) NO NO
ANK3 Chr10:62494029 A/G point mutation ANK3 1 (0/1/0) NO NO
GABRA1 -471T/C point mutation GABRA1 1 (0/1/0) NO YES
NRG1 SNP8NRG221132 point mutation NRG1 1 (0/1/0) YES NO
ANK3 Chr10:62494113 C/T point mutation ANK3 1 (0/1/0) NO NO
GABRA1 IVS2-712(GT)n microsatellite GABRA1 1 (1/0/0) NO YES
ANK3 Chr10:62494201 CT/CTATATTAT insertion/deletion ANK3 1 (0/1/0) NO NO
GABRA1 IVS9+76A/G point mutation GABRA1 1 (0/1/0) NO YES
CACNA1C Chr12:2161733 G/C point mutation CACNA1C 1 (0/1/0) NO NO
GABRA3 (AC)n duplication GABRA3 1 (0/1/0) NO NO
CACNA1C Chr12:2161930 C/T point mutation CACNA1C 1 (0/1/0) NO NO
GABRA3 CA repeat microsatellite GABRA3 1 (1/0/0) NO NO
NTS 166C>G point mutation NTS 1 (0/1/0) NO NO
CACNA1C Chr12:2161934 G/A point mutation Promoter CACNA1C 1 (0/1/0) NO NO
GABRA3 GDB156286 VNTR GABRA3 1 (0/1/0) NO NO
NTS 3A>G point mutation NTS 1 (1/0/0) NO NO
CACNA1C Chr12:2161984 C/A point mutation CACNA1C 1 (0/1/0) NO NO
GABRA5 +11547 (CA)n microsatellite GABRA5 1 (0/1/0) NO NO
P2RX7 NBG6 microsatellite P2RX7 1 (1/0/0) NO NO
CACNA1C Chr12:2162059 -/GGGG/CGGG/AGGG insertion/deletion CACNA1C 1 (0/1/0) NO NO
GABRA5 3'UTR 1-8 allele others GABRA5 1 (1/0/0) NO YES
P2RX7 P2RX73 duplication P2RX7 1 (0/1/0) NO NO
CACNA1C Chr12:2162201 -/CGGCG insertion/deletion CACNA1C 1 (0/1/0) NO NO
GABRA5 (CA)n polymorphic dinucleotide repeat marker GABRA5 1 (1/0/0) NO YES
PCNT2-AluI microsatellite 21q22.3 1 (0/1/0) NO NO
CACNA1C Chr12:2162217 G/A point mutation CACNA1C 1 (0/1/0) NO NO
GABRA5 GDB162554 VNTR GABRA5 1 (1/0/0) NO NO
PENK polymorphisms VNTR PENK 1 (0/1/0) NO NO
CACNA1C Chr12:2272007 C/T point mutation CACNA1C 1 (0/1/0) NO NO
GABRb1 (GATA)n tetranucleotide repeat GABRB1 1 (1/0/0) NO NO
PER2 2087A/G point mutation PER2 1 (0/1/0) NO NO
CACNA1C Chr12:2284208 -/TGTTCAAACCTGTGT insertion/deletion CACNA1C 1 (0/1/0) NO NO
GABRB3 (CA) repeat microsatellite GABRB3 1 (0/1/0) NO NO
PER2 2114G/A point mutation PER2 1 (0/1/0) NO NO
CACNA1C Chr12:2286800 -/TCTTTCTT insertion/deletion CACNA1C 1 (0/1/0) NO NO
GABRB3 GDB160763 VNTR GABRB3 1 (0/1/0) NO NO
PER2 2117G/A point mutation PER2 1 (0/1/0) NO NO
CACNA1C Chr12:2286819 -/TT insertion/deletion CACNA1C 1 (0/1/0) NO NO
GCH1 -959G/A point mutation GCH1 1 (1/0/0) NO NO
PFKL microsatellite 21q22.3 1 (0/1/0) NO NO
CACNA1C Chr12:2286820 -/T insertion/deletion CACNA1C 1 (0/1/0) NO NO
GCLC 5'UTR repeat microsatellite 5'UTR GCLC 1 (0/1/0) NO NO
PIK3C3 -432C->T point mutation PIK3C3 1 (1/0/0) YES NO
CACNA1C Chr12:2291321 -/AT insertion/deletion CACNA1C 1 (0/1/0) NO NO
GNAL intron10 T/G point mutation intron10 GNAL 1 (0/1/0) NO NO
PIK3C3 promoter -86insC insertion/deletion promoter PIK3C3 1 (0/0/1) YES NO
CACNA1C Chr12:2292413 -/A insertion/deletion CACNA1C 1 (0/1/0) NO NO
GNAL intron3 A/G point mutation intron 3 GNAL 1 (0/1/0) NO NO
PIK4CA -31(A>G) point mutation PI4KA 1 (0/1/0) YES NO
CACNA1C Chr12:2292742 -/C insertion/deletion CACNA1C 1 (0/1/0) NO NO
GNAZ exon2 309C/T SNP exon2 GNAZ 1 (1/0/0) NO NO
PIK4CA E2079Q point mutation PI4KA 1 (0/1/0) YES NO
CACNA1C Chr12:2296694 -/T insertion/deletion CACNA1C 1 (0/1/0) NO NO
GNB3 C825T point mutation GNB3 1 (0/1/0) YES YES
PIK4CA R2259C point mutation PI4KA 1 (0/1/0) YES NO
CACNA1C Chr12:2296695 GG/TGG insertion/deletion CACNA1C 1 (0/1/0) NO NO
PIP5K2A -1007C>T point mutation PIP4K2A 1 (0/1/0) YES NO
CACNA1C Chr12:2297340 -/CT insertion/deletion CACNA1C 1 (0/1/0) NO NO
GRIN1 exon6 19700A/G point mutation exon6 GRIN1 1 (0/1/0) NO NO
PIP5K2A Exon10 1257T->G point mutation exon10 PIP4K2A 1 (0/0/1) NO NO
CACNA1C Chr12:2297530 -/CT insertion/deletion CACNA1C 1 (0/1/0) NO NO
GRIN1 intron11 6608A/G point mutation intron11 GRIN1 1 (1/0/0) NO NO
PIP5K2A Exon10 1412G->C point mutation exon 0 PIP4K2A 1 (0/0/1) NO NO
CACNA1C Chr12:2300919 -/CA insertion/deletion CACNA1C 1 (0/1/0) NO NO
GRIN1 promoter 1001G/C point mutation promoter GRIN1 1 (1/0/0) NO NO
PIP5K2A Exon10 Codon 391(GAA->GAG) point mutation exon10_codon391 PIP4K2A 1 (0/0/1) NO NO
CACNA1C Chr12:2300934 -/CTCCACAGGCACAT insertion/deletion CACNA1C 1 (0/1/0) NO NO
GRIN2A promoter (GT)n microsatellite promoter GRIN2A 1 (1/0/0) NO NO
PIP5K2A Exon5 Codon 199(GTA->GTG) point mutation exon5_codon199 PIP4K2A 1 (0/0/1) NO NO
CACNA1C Chr12:2301013 -/CACT insertion/deletion CACNA1C 1 (0/1/0) NO NO
PIP5K2A Exon7 N251S point mutation exon7 PIP4K2A 1 (0/0/1) NO NO
CACNA1C Chr12:2301016 -/T insertion/deletion CACNA1C 1 (0/1/0) NO NO
GRIN2B 366C/G point mutation GRIN2B 1 (0/1/0) NO NO
PIP5K2A Exon8 Codon 309(CCG->CCA) point mutation exon8_codon309 PIP4K2A 1 (0/0/1) NO NO
CACNA1C Chr12:2301048 -/G insertion/deletion CACNA1C 1 (0/1/0) NO NO
GRIN2B A5806C point mutation GRIN2B 1 (1/0/0) YES NO
PIP5K2A Exon8 IVS8+20C->G point mutation exon 8 PIP4K2A 1 (0/0/1) NO NO
CACNA1C Chr12:2301049 -/T insertion/deletion CACNA1C 1 (0/1/0) NO NO
GRIN2B T5988C point mutation GRIN2B 1 (1/0/0) YES NO
PIP5K2A Exon9 Intron 9 CT repeat microsatellite exon 9_intron9 PIP4K2A 1 (1/0/0) YES NO
CACNA1C Chr12:2301051 -/C insertion/deletion CACNA1C 1 (0/1/0) NO NO
GRK3 129964 SNP37 point mutation ADRBK2 1 (0/1/0) NO NO
PKNOX1 microsatellite 21q22.3 1 (0/1/0) NO NO
CACNA1C Chr12:2301188 -/ATAC/ACAC insertion/deletion CACNA1C 1 (0/1/0) NO NO
GRK3 14087 SNP23 point mutation ADRBK2 1 (1/0/0) NO NO
CACNA1C Chr12:2302620 -/A insertion/deletion CACNA1C 1 (0/1/0) NO NO
GRK3 14454 SNP24 point mutation ADRBK2 1 (0/1/0) NO NO
CACNA1C Chr12:2302621 -/A/AA insertion/deletion CACNA1C 1 (0/1/0) NO NO
GRK3 15401 SNP28 point mutation ADRBK2 1 (1/0/0) NO NO
PLA2G10 (AAT)n microsatellite PLA2G10 1 (0/1/0) NO NO
CACNA1C Chr12:2308364 -/GG insertion/deletion CACNA1C 1 (0/1/0) NO NO
GRK3 15667 SNP29 point mutation ADRBK2 1 (0/1/0) NO NO
PLCG1 exon26 C/T point mutation exon26 PLCG1 1 (0/1/0) NO NO
CACNA1C Chr12:2308644 -/C insertion/deletion CACNA1C 1 (0/1/0) NO NO
GRK3 20256 SNP32 point mutation ADRBK2 1 (0/1/0) NO NO
PLCG1 exon31 G/T point mutation exon31 PLCG1 1 (0/1/0) NO NO
CACNA1C Chr12:2314099 AAAGTATAA/- insertion/deletion CACNA1C 1 (0/1/0) NO NO
GRK3 2992 SNP14 point mutation ADRBK2 1 (0/1/0) NO NO
PLCG1 exon9 A/G point mutation exon9 PLCG1 1 (0/1/0) NO NO
CACNA1C Chr12:2314103 -/A insertion/deletion CACNA1C 1 (0/1/0) NO NO
GRK3 600 SNP12 point mutation ADRBK2 1 (0/1/0) NO NO
PON1 L55M point mutation PON1 1 (1/0/0) NO NO
CACNA1C Chr12:2317001 -/AA/AAA insertion/deletion CACNA1C 1 (0/1/0) NO NO
GRK3 9046 SNP19 point mutation ADRBK2 1 (0/1/0) NO NO
PON1 Q192R point mutation PON1 1 (1/0/0) NO NO
CACNA1C Chr12:2317010 A/C point mutation CACNA1C 1 (0/1/0) NO NO
GRK3 P-1 point mutation ADRBK2 1 (1/0/0) NO NO
PPP2R2C Intron1d 99-24169/139 point mutation Intron1d PPP2R2C 1 (1/0/0) NO NO
CACNA1C Chr12:2317010 AC/CC point mutation CACNA1C 1 (0/1/0) NO NO
GRK3 P-2 point mutation ADRBK2 1 (0/1/0) NO NO
PPP2R2C Intron4 24-247/216 point mutation Intron4 PPP2R2C 1 (1/0/0) NO NO
CACNA1C Chr12:2321310 -/C insertion/deletion CACNA1C 1 (0/1/0) NO NO
GRK3 P-5 point mutation ADRBK2 1 (1/0/0) NO NO
PPP2R2C Intron5 24-257/320 point mutation Intron5 PPP2R2C 1 (1/0/0) NO NO
CACNA1C Chr12:2323140 -/T insertion/deletion CACNA1C 1 (0/1/0) NO NO
GRK3 P-6 point mutation ADRBK2 1 (1/0/0) NO NO
PPP2R2C Intron5 99-24175/218 point mutation Intron5 PPP2R2C 1 (1/0/0) NO NO
CACNA1C Chr12:2323807 A/C point mutation CACNA1C 1 (0/1/0) NO NO
GRK3 SNP36 point mutation ADRBK2 1 (0/1/0) NO NO
PPP3CC-CC33 point mutation PPP3CC 1 (1/0/0) NO NO
CACNA1C Chr12:2328828 A/T point mutation CACNA1C 1 (0/1/0) NO NO
GRM3 +1131C/T point mutation GRM3 1 (0/1/0) YES NO
PPP3CC-CCS3 point mutation PPP3CC 1 (1/0/0) NO NO
CACNA1C Chr12:2329069 G/T point mutation intron CACNA1C 1 (0/1/0) NO NO
GRM7 hcv11751218 point mutation GRM7 1 (1/0/0) NO NO
PRKCZ(AC)24 microsatellite PRKCZ 1 (0/1/0) NO NO
CACNA1C Chr12:2332571 T/- insertion/deletion CACNA1C 1 (0/1/0) NO NO
PRKCZ(CA)13 microsatellite PRKCZ 1 (0/1/0) NO NO
CACNA1C Chr12:2334223 -/G insertion/deletion CACNA1C 1 (0/1/0) NO NO
PRKCZ(GT)17 microsatellite PRKCZ 1 (0/1/0) NO NO
CACNA1C Chr12:2335287 -/CG insertion/deletion CACNA1C 1 (0/1/0) NO NO
GSTM1 positive/null insertion/deletion GSTM1 1 (1/0/0) NO NO
PRODH-1482 point mutation PRODH 1 (0/1/0) YES NO
CACNA1C Chr12:2335288 -/CG/CGCG insertion/deletion CACNA1C 1 (0/1/0) NO NO
GSTT1 positive/null insertion/deletion GSTT1 1 (0/1/0) NO NO
PRODH-1945 point mutation PRODH 1 (0/1/0) YES NO
CACNA1C Chr12:2335298 -/A/C insertion/deletion CACNA1C 1 (0/1/0) NO NO
16p11.2 microduplications duplication 0 (0/0/0) NO NO
SLC1A2 Chr11:35441380 G/C Chr11:35441380 SLC1A2 0 (0/0/0) NO NO
SLC1A2 Chr11:35441311 G/A Chr11:35441311 SLC1A2 0 (0/0/0) NO NO
MAOA microsatellite polymorphisms microsatellite MAOA 0 (0/0/0) NO NO
SLC1A2 Chr11:35441254 C/T Chr11:35441254 SLC1A2 0 (0/0/0) NO NO
SLC1A2 Chr11:35440927 A/G Chr11:35440927 SLC1A2 0 (0/0/0) NO NO
SLC1A2 Chr11:35440635 G/A Chr11:35440635 SLC1A2 0 (0/0/0) NO NO
SLC1A2 Chr11:35440563 C/G Chr11:35440563 SLC1A2 0 (0/0/0) NO NO
SLC1A2 Chr11:35440498 G/A Chr11:35440498 SLC1A2 0 (0/0/0) NO NO
SLC1A2 Chr11:35344202 G/T Chr11:35344202 SLC1A2 0 (0/0/0) NO NO
SLC1A2 Chr11:35344107 G/A Chr11:35344107 SLC1A2 0 (0/0/0) NO NO
SLC1A2 Chr11:35339061 C/T Chr11:35339061 SLC1A2 0 (0/0/0) NO NO
SLC1A2 Chr11:35338989 G/A Chr11:35338989 SLC1A2 0 (0/0/0) NO NO
SLC1A2 Chr11:35282452 C/T Chr11:35282452 SLC1A2 0 (0/0/0) NO NO
SLC1A2 Chr11:35280227 C/T Chr11:35280227 SLC1A2 0 (0/0/0) NO NO
SLC1A2 Chr11:35279202 A/G Chr11:35279202 SLC1A2 0 (0/0/0) NO NO
SLC1A2 Chr11:35276479 C/T Chr11:35276479 SLC1A2 0 (0/0/0) NO NO