BDgene

Other Variant

Search by:

Total result: 918

Variant Name Variant Type Location in Gene Related Gene No. of Studies (Positive/Negative/Trend) Overlap with SZ Overlap with MDD
5HTTLPR microsatellite promoter SLC6A4 41 (12/29/0) YES YES
BDNF Val66Met point mutation BDNF 21 (11/10/0) YES YES
SLC6A4 intron2 VNTR VNTR intron2 SLC6A4 16 (4/12/0) YES YES
COMT Val158Met point mutation COMT 14 (2/12/0) NO YES
MTHFR C677T point mutation MTHFR 13 (5/8/0) YES YES
MAOA promoter VNTR VNTR promoter MAOA 9 (0/9/0) NO YES
DRD3 Ser9Gly point mutation DRD3 9 (2/7/0) NO YES
HTR2A C102T point mutation HTR2A 8 (0/8/0) YES YES
MAOA (CA)n microsatellite MAOA 8 (5/3/0) NO YES
DRD4 exon3 VNTR VNTR exon3 DRD4 8 (1/7/0) YES YES
TPH1 A218C point mutation intron 7 TPH1 6 (2/4/0) YES YES
DRD3 BalI Polymorphism point mutation DRD3 6 (1/5/0) NO NO
5-HTT intron 2 VNTR VNTR SLC6A4 5 (1/4/0) NO YES
TH intron 1 tetranucleotide repeat duplication intron 1 TH 5 (0/5/0) NO YES
DRD1 -48A/G point mutation DRD1 5 (3/2/0) YES NO
DRD2 S311C point mutation DRD2 5 (0/5/0) YES YES
HTR2A -1438A/G point mutation HTR2A 4 (1/3/0) NO YES
SERT VNTR VNTR SLC6A4 4 (2/2/0) YES YES
ACE insertion/deletion insertion/deletion ACE 4 (2/2/0) YES YES
KCNN3 exon 1 CAG-repeat microsatellite exon 1 KCNN3 4 (0/4/0) YES NO
TH TaqI Polymorphism SNP TH 4 (2/2/0) NO YES
MTHFR A1298C point mutation MTHFR 4 (3/1/0) YES YES
rs6195 point mutation NR3C1 3 (0/3/0) NO YES
HTR2A 516C/T point mutation HTR2A 3 (1/2/0) NO NO
HTR2A His452Tyr point mutation HTR2A 3 (0/3/0) NO NO
HTR2C Cys23Ser point mutation HTR2C 3 (3/0/0) NO YES
BDNF 196G/A point mutation BDNF 3 (2/1/0) NO NO
BDNF (GT)n microsatellite BDNF 3 (2/1/0) YES YES
TCF4 CTG18.1 microsatellite TCF4 3 (1/2/0) YES NO
TH PstI Polymorphism SNP TH 3 (0/3/0) NO YES
WFS1 G576S point mutation exon8 WFS1 3 (0/3/0) NO YES
WFS1 H611R point mutation exon8 WFS1 3 (0/3/0) NO YES
MAOA RFLP point mutation MAOA 3 (1/2/0) NO NO
MAOA T941G point mutation MAOA 3 (2/1/0) YES YES
MAOB (GT)n microsatellite MAOB 3 (1/2/0) NO YES
DAT VNTR VNTR SLC6A3 3 (0/3/0) NO NO
DDC 1bp del insertion/deletion DDC 3 (2/1/0) NO YES
XBP1 -116C>G point mutation XBP1 3 (1/2/0) NO NO
DDC 4bp del insertion/deletion DDC 3 (1/2/0) NO YES
DRD2 141ins/del insertion/deletion DRD2 3 (1/2/0) NO NO
DRD2 TaqIA point mutation DRD2 3 (1/2/0) NO NO
DRD2 TaqI Polymorphism SNP DRD2 3 (0/3/0) NO NO
ERDA1 microsatellite microsatellite ERDA1 3 (0/3/0) YES NO
NRG1 SNP8NRG241930 point mutation NRG1 3 (0/3/0) YES NO
NRG1 SNP8NRG243177 point mutation NRG1 3 (0/3/0) YES NO
GPR50 delta502-505 insertion/deletion GPR50 3 (1/2/0) YES YES
GSK3B -1727A/T point mutation promoter GSK3B 3 (0/3/0) YES NO
GSK3B -50T/C point mutation promoter GSK3B 3 (0/3/0) YES NO
RGS4 SNP1 point mutation RGS4 2 (0/2/0) YES NO
5-HT2A His452Tyr point mutation in the intracellular C-terminal end of the 5-HT2A protein HTR2A 2 (1/1/0) NO NO
5-HT2A T102C point mutation HTR2A 2 (0/2/0) NO NO
HTR2A Thr25Asn point mutation HTR2A 2 (0/2/0) NO NO
ADCY9 2316A>G point mutation ADCY9 2 (1/1/0) NO YES
ADCY9 (TTTA)n microsatellite ADCY9 2 (1/1/0) NO YES
SLC6A3 -67A/T point mutation SLC6A3 2 (2/0/0) NO NO
HTR6 267C/T point mutation HTR6 2 (1/1/0) YES YES
IL1RN intron 2 VNTR VNTR intron 2 IL1RN 2 (1/1/0) YES NO
IMPA2 -185A>G point mutation IMPA2 2 (0/2/0) YES NO
IMPA2 -207T>C point mutation IMPA2 2 (2/0/0) YES NO
SYBL1 intron5 G>C point mutation intron5 VAMP7 2 (0/2/0) NO NO
IMPA2 443G>A (R148Q) point mutation IMPA2 2 (0/2/0) NO NO
IMPA2 -461C>T point mutation IMPA2 2 (1/1/0) NO NO
BDNF-LCPR microsatellite approximately 1.0 kb upstream of the translation initiation site of the BDNF gene BDNF 2 (1/1/0) NO NO
IMPA2 -97-15G>A point mutation IMPA2 2 (0/2/0) NO NO
TH BglII Polymorphism SNP TH 2 (2/0/0) NO NO
COMT H/L others COMT 2 (1/1/0) NO YES
TH TaqI RFLP RFLP TH 2 (1/1/0) NO NO
TNF -G308A point mutation TNF 2 (1/1/0) YES NO
TPH1 intron 7 218A/C SNP intron 7 TPH1 2 (0/2/0) NO YES
DAT 40bp repeat duplication SLC6A3 2 (0/2/0) NO YES
MAOA VNTR VNTR MAOA 2 (2/0/0) NO NO
mtDNA A10398G point mutation mtDNA 2 (1/1/0) NO NO
mtDNA C5178A point mutation mtDNA 2 (1/1/0) NO NO
DRD1 1403T/C point mutation DRD1 2 (1/1/0) NO NO
NDUFV2 -233T>C point mutation NDUFV2 2 (0/2/0) NO NO
DRD1 -800T/C point mutation DRD1 2 (1/1/0) NO NO
NDUFV2 -602G>A point mutation NDUFV2 2 (1/1/0) NO NO
NDUFV2 -796C>G point mutation NDUFV2 2 (0/2/0) NO NO
NDUFV2 86C>T point mutation NDUFV2 2 (0/2/0) NO NO
DRD2 RFLP SNP DRD2 2 (0/2/0) NO NO
DRD4 -521T/C point mutation DRD4 2 (0/2/0) NO NO
NOS1 promoter VNTR VNTR promoter NOS1 2 (0/2/0) YES NO
NOTCH4 (CTG)n microsatellite NOTCH4 2 (1/1/0) NO NO
NRG1 420M9-1395 microsatellite NRG1 2 (0/2/0) NO NO
NRG1 478B14-848 microsatellite NRG1 2 (0/2/0) NO NO
NRG1 SNP8NRG221533 point mutation NRG1 2 (0/2/0) YES NO
GRIN2B -200G/T point mutation GRIN2B 2 (0/2/0) YES NO
PLA2 1-8 allele duplication PLA2G1B 2 (0/2/0) NO NO
PLA2G1B microsatellite polymorphisms microsatellite PLA2G1B 2 (2/0/0) NO NO
HARS TaqI Polymorphism SNP HARS 1 (0/1/0) NO NO
PRODH-2026 point mutation PRODH 1 (0/1/0) YES NO
CACNA1C Chr12:2335301 -/G/A insertion/deletion CACNA1C 1 (0/1/0) NO NO
HDAT-PCR1 SNP SLC6A3 1 (1/0/0) NO NO
PRODH exon12 A472T point mutation exon12 PRODH 1 (0/1/0) YES NO
CACNA1C Chr12:2335333 -/ACACACAG/ACACACAC insertion/deletion CACNA1C 1 (0/1/0) NO NO
218C10.CA44 microsatellite 21q23 1 (0/1/0) NO NO
hKCa CAG repeat duplication KCNN3 1 (0/1/0) NO NO
PRODH exon12 R431H point mutation exon12 PRODH 1 (0/1/0) YES NO
CACNA1C Chr12:2335340 -/G/C insertion/deletion CACNA1C 1 (0/1/0) NO NO
22A5.GT124 microsatellite 21q23 1 (0/1/0) NO NO
HLA-A polymorphism others HLA-A 1 (0/1/0) NO NO
RFX4 D12S2072 microsatellite RFX4 1 (1/0/0) NO NO
CACNA1C Chr12:2336695 G/A point mutation CACNA1C 1 (0/1/0) NO NO
22CH3 CAG repeat microsatellite 1 (1/0/0) YES NO
HLA-B polymorphism others HLA-B 1 (0/1/0) NO NO
RGS4 SNP18 point mutation RGS4 1 (0/1/0) YES NO
CACNA1C Chr12:2338101 -/TA/TATG insertion/deletion CACNA1C 1 (0/1/0) NO NO
-2 bp deletion polymorphism insertion/deletion 1 Mb apart from CHRNA7 CHRNA7 1 (1/0/0) NO NO
HM74a GC09E01A point mutation HCAR2 1 (0/1/0) NO NO
CACNA1C Chr12:2338102 -/TG insertion/deletion CACNA1C 1 (0/1/0) NO NO
314n7CA23 microsatellite 21q23 1 (0/1/0) NO NO
HM74a GC09E01B point mutation HCAR2 1 (0/1/0) NO NO
RGS4 SNP4 point mutation RGS4 1 (0/1/0) YES NO
CACNA1C Chr12:2338946 G/A point mutation CACNA1C 1 (0/1/0) NO NO
314n7CA28 microsatellite 21q23 1 (0/1/0) NO NO
HM74 GC10E01A point mutation HCAR3 1 (0/1/0) NO NO
RGS4 SNP7 point mutation RGS4 1 (1/0/0) YES NO
CACNA1C Chr12:2339781 G/C point mutation CACNA1C 1 (0/1/0) NO NO
314n7CT18 microsatellite 21q23 1 (0/1/0) NO NO
HM74 GC10E01B point mutation HCAR3 1 (0/1/0) NO NO
rs1129647 point mutation GABRA1 1 (1/0/0) NO YES
CACNA1C Chr12:2341084 -/T insertion/deletion CACNA1C 1 (0/1/0) NO NO
HM74 GC10E01C point mutation HCAR3 1 (0/1/0) NO NO
rs1599988 point mutation mtDNA 1 (1/0/0) YES NO
CACNA1C Chr12:2341393 -/G insertion/deletion CACNA1C 1 (0/1/0) NO NO
5-HT2A promoter 1438A/G point mutation promoter HTR2A 1 (1/0/0) NO NO
HM74 GC10E01D point mutation HCAR3 1 (0/1/0) NO NO
rs28357375 point mutation mtDNA 1 (1/0/0) NO NO
CACNA1C Chr12:2341397 G/T point mutation CACNA1C 1 (0/1/0) NO NO
HM74 GC10E01E point mutation HCAR3 1 (0/1/0) NO NO
rs28357968 point mutation mtDNA 1 (1/0/0) NO NO
CACNA1C Chr12:2347245 -/TT insertion/deletion CACNA1C 1 (0/1/0) NO NO
5-HTR2C RFLP SNP HTR2C 1 (0/1/0) NO NO
HTR1A (CA)n/(GT)n 10 duplication HTR1A 1 (0/1/0) NO NO
rs2853515 point mutation mtDNA 1 (1/0/0) YES NO
CACNA1C Chr12:2349920 -/TGGCCTCCTCA insertion/deletion CACNA1C 1 (0/1/0) NO NO
HTR1B G861C point mutation HTR1B 1 (0/1/0) NO NO
rs3937033 point mutation mtDNA 1 (1/0/0) YES NO
CACNA1C Chr12:2349920 GTGGCCTCCTCAT/GT insertion/deletion CACNA1C 1 (0/1/0) NO NO
HTR1B T371G point mutation HTR1B 1 (0/1/0) NO NO
CACNA1C Chr12:2352902 G/A point mutation CACNA1C 1 (0/1/0) NO NO
5-HTT PstI RFLP SNP SLC6A4 1 (0/1/0) NO NO
HTR1D HincII Polymorphism SNP HTR1D 1 (0/1/0) NO NO
rs6414684 point mutation GABRB1 1 (1/0/0) NO NO
CACNA1C Chr12:2354984 C/T point mutation CACNA1C 1 (0/1/0) NO NO
AADC exon 1 T>A point mutation exon 1 DDC 1 (0/1/0) YES NO
HTR1D TaqI Polymorphism SNP HTR1D 1 (0/1/0) NO NO
rs769404 point mutation GAD1 1 (0/1/0) YES NO
CACNA1C Chr12:2362014 G/C point mutation CACNA1C 1 (0/1/0) NO NO
ABCA13 exon33 H3609P point mutation exon33 ABCA13 1 (0/1/0) YES YES
HTR2A 1018578T/G point mutation HTR2A 1 (0/1/0) NO NO
rs854560 point mutation PON1 1 (1/0/0) NO NO
CACNA1C Chr12:2365088 G/T point mutation CACNA1C 1 (0/1/0) NO NO
ABCA13 exon40 T4031A point mutation exon40 ABCA13 1 (1/0/0) YES YES
HTR2A 1018579A/G point mutation HTR2A 1 (0/1/0) NO NO
RSN GC04E12A point mutation CLIP1 1 (0/1/0) NO NO
CACNA1C Chr12:2365131 C/T point mutation CACNA1C 1 (0/1/0) NO NO
ABCA13 exon52 R4590W point mutation exon52 ABCA13 1 (0/1/0) YES YES
HTR2A 1354C/T point mutation HTR2A 1 (1/0/0) NO NO
RSN GC04E14A point mutation CLIP1 1 (0/1/0) NO NO
CACNA1C Chr12:2370397 -/A insertion/deletion CACNA1C 1 (0/1/0) NO NO
ABCA13 exon52 T4550A point mutation exon52 ABCA13 1 (1/0/0) YES YES
HTR2A 1360020G/T point mutation HTR2A 1 (0/1/0) NO NO
RSN GC04E19A point mutation CLIP1 1 (0/1/0) NO NO
CACNA1C Chr12:2370911 -/ACACAC insertion/deletion CACNA1C 1 (0/1/0) NO NO
ABCA13 exon54 R4728X point mutation exon54 ABCA13 1 (0/1/0) YES YES
S100B-HaeIII microsatellite 21q22.3 1 (0/1/0) NO NO
CACNA1C Chr12:2375362 -/TT insertion/deletion CACNA1C 1 (0/1/0) NO NO
ABCA13 exon57 R4843C point mutation exon57 ABCA13 1 (0/1/0) YES YES
HTR2A 1854352A/G point mutation HTR2A 1 (0/1/0) NO NO
SBNO1 GC22E16A point mutation SBNO1 1 (0/1/0) NO NO
CACNA1C Chr12:2381652 G/A point mutation CACNA1C 1 (0/1/0) NO NO
ABCG1 1248+14insC insertion/deletion ABCG1 1 (0/1/0) NO NO
CACNA1C Chr12:2385027 -/A insertion/deletion CACNA1C 1 (0/1/0) NO NO
ABCG1 1249-64G>T point mutation ABCG1 1 (0/1/0) NO NO
HTR2A 74C/A point mutation HTR2A 1 (0/1/0) NO NO
SCYA2 A-2518G point mutation promoter CCL2 1 (1/0/0) NO YES
CACNA1C Chr12:2385246 G/T point mutation CACNA1C 1 (0/1/0) NO NO
ABCG1 274+11C>T point mutation ABCG1 1 (0/1/0) NO NO
HTR2A BbvI Polymorphism SNP HTR2A 1 (0/1/0) NO NO
SEF2-1B microsatellite 1 (0/1/0) YES NO
CACNA1C Chr12:2389778 G/A point mutation CACNA1C 1 (0/1/0) NO NO
ABCG1 -533A>G point mutation ABCG1 1 (0/1/0) NO NO
SERT insertion/deletion insertion/deletion SLC6A4 1 (1/0/0) NO NO
CACNA1C Chr12:2391029 -/T insertion/deletion CACNA1C 1 (0/1/0) NO NO
ABCG1 576+139A>G point mutation ABCG1 1 (0/1/0) NO NO
CACNA1C Chr12:2392186 -/T insertion/deletion CACNA1C 1 (0/1/0) NO NO
ABCG1 723-20C>T point mutation ABCG1 1 (0/1/0) NO NO
HTR2A HpaII Polymorphism point mutation HTR2A 1 (0/1/0) NO NO
SLC12A6 32416574(G/A) point mutation SLC12A6 1 (1/0/0) YES NO
CACNA1C Chr12:2418658 -/AC insertion/deletion CACNA1C 1 (0/1/0) NO NO
ABCG1 -768G>A point mutation ABCG1 1 (0/1/0) NO NO
HTR2A MspI Polymorphism SNP HTR2A 1 (1/0/0) NO NO
SLC12A6 32418760(G/A) point mutation SLC12A6 1 (1/0/0) YES NO
CACNA1C Chr12:2418658 -/T/TAC insertion/deletion CACNA1C 1 (0/1/0) NO NO
ABCG1 A2424G point mutation ABCG1 1 (0/1/0) NO NO
SLC12A6 IVS4+1008ins(T)/del(T) insertion/deletion SLC12A6 1 (1/0/0) YES NO
CACNA1C Chr12:2418659 AC/ACAC duplication CACNA1C 1 (0/1/0) NO NO
ABCG1 D21S1225 microsatellite ABCG1 1 (1/0/0) NO NO
SLC1A4-11 microsatellite SLC1A4 1 (0/1/0) YES NO
CACNA1C Chr12:2419508 -/A insertion/deletion CACNA1C 1 (0/1/0) NO NO
ABCG1 I6 61VNTR VNTR ABCG1 1 (0/1/0) NO NO
HTR2C GT(12-18)/CT(4-5) microsatellite HTR2C 1 (0/1/0) NO NO
SLC6A3 1342A/G point mutation SLC6A3 1 (0/1/0) NO NO
CACNA1C Chr12:2419516 A/T/AAT point mutation/duplication CACNA1C 1 (0/1/0) NO NO
ABCG1 UTR poly(T) VNTR ABCG1 1 (0/1/0) NO NO
HTR2C HinfI Polymorphism SNP HTR2C 1 (1/0/0) NO NO
SLC6A3 1398-21G/A point mutation SLC6A3 1 (0/1/0) NO NO
CACNA1C Chr12:2421980 -/T insertion/deletion CACNA1C 1 (0/1/0) NO NO
ACE1 dbSNP4295 point mutation ACE 1 (0/1/0) NO NO
HTR3A C178T point mutation HTR3A 1 (1/0/0) NO NO
SLC6A3 1398-56A/G point mutation SLC6A3 1 (0/1/0) NO NO
CACNA1C Chr12:2423175 G/C point mutation Intron CACNA1C 1 (0/1/0) NO NO
HTR3A C195T point mutation HTR3A 1 (0/1/0) NO NO
SLC6A3 1436209 C>G point mutation SLC6A3 1 (0/1/0) NO NO
CACNA1C Chr12:2694668 G/A point mutation Splice site CACNA1C 1 (0/1/0) NO NO
ADARB1 c.2234A>G point mutation exon10 ADARB1 1 (0/1/0) NO NO
HTR3A exon1 Leu10Leu point mutation exon1 HTR3A 1 (0/1/0) YES NO
SLC6A3 1626+14G/A point mutation SLC6A3 1 (0/1/0) NO NO
CACNA1C Chr12:2788668 C/G point mutation CACNA1C 1 (0/1/0) NO NO
HTR3A exon3 A(+7 IVS3)C point mutation exon3 HTR3A 1 (0/1/0) YES NO
SLC6A3 1859C/T point mutation SLC6A3 1 (0/1/0) NO NO
CACNA1C Chr12:2800689 A/G point mutation CACNA1C 1 (0/1/0) NO NO
HTR3A exon6 Leu192Leu point mutation exon6 HTR3A 1 (0/1/0) YES NO
SLC6A3 1967+29insTC insertion/deletion SLC6A3 1 (0/1/0) NO NO
CACNA1C Chr12:2800954 GCACGGGCCACGCCGAGCTCCCGGCCA/- insertion/deletion CACNA1C 1 (0/1/0) NO NO
ADCYAP1 IVS3 37A/T point mutation ADCYAP1 1 (0/1/0) YES NO
HTR3A exon7 Lys277Lys point mutation exon7 HTR3A 1 (0/1/0) YES NO
SLC6A3 242C/T point mutation SLC6A3 1 (0/1/0) NO NO
CACNA1C Chr12:2801016 C/G/CGCCGCCGGGAAGGG point mutation/insertion CACNA1C 1 (0/1/0) NO NO
ADRA1A 492C>T point mutation exon 2 ADRA1A 1 (0/1/0) NO NO
HTR3A exon8 Arg344His point mutation exon8 HTR3A 1 (0/1/0) YES NO
SLC6A3 3'UTR VNTR VNTR 3'UTR SLC6A3 1 (0/1/0) YES NO
CACNA1C Chr12:2801133 T/A point mutation CACNA1C 1 (0/1/0) NO NO
ADRA1B hcv1738292 point mutation ADRA1B 1 (1/0/0) NO NO
HTR3A exon9 Leu459Leu point mutation exon9 HTR3A 1 (0/1/0) YES NO
SLC6A3 547-12C/A point mutation SLC6A3 1 (0/1/0) NO NO
CACNA1C Chr12:2803097 T/G point mutation CACNA1C 1 (0/1/0) NO NO
ADRA2A -1291C>G point mutation ADRA2A 1 (0/1/0) NO NO
HTR3A exon9 Pro391Arg point mutation exon9 HTR3A 1 (0/1/0) YES NO
CACNA1C Chr12:2804191 T/G point mutation CACNA1C 1 (0/1/0) NO NO
ADRA2C 5'UTR (GT)n microsatellite 5' UTR ADRA2C 1 (0/1/0) NO NO
HTR3B 386A>C (Tyr129Ser) point mutation HTR3B 1 (1/0/0) YES NO
SLC6A3 Ala559Val point mutation SLC6A3 1 (0/1/0) NO NO
CACNA1C Chr12:2804268 T/- insertion/deletion CACNA1C 1 (0/1/0) NO NO
AGAT10 microsatellite 21q23 1 (0/1/0) NO NO
HTR3B 547G>A (Val183Ile) point mutation HTR3B 1 (1/0/0) YES NO
SLC6A3 Glu602Gly point mutation SLC6A3 1 (0/1/0) NO NO
CACNA1C Chr12:2804832 G/- insertion/deletion CACNA1C 1 (0/1/0) NO NO
AGT M235T point mutation AGT 1 (1/0/0) NO NO
HTR3B 5'UTR -102delAAG insertion/deletion 5'UTR HTR3B 1 (1/0/0) YES NO
SLC6A3 I11+2478 point mutation SLC6A3 1 (0/1/0) NO NO
CACNA1C Chr12:2806546 G/A point mutation CACNA1C 1 (0/1/0) NO NO
ALDH2 *1/*2 point mutation ALDH2 1 (1/0/0) NO NO
HTR3B IVS4+11C>T point mutation HTR3B 1 (0/1/0) YES NO
SLC6A3 I12+268 point mutation SLC6A3 1 (0/1/0) NO NO
MTHFR exon 4 C677T SNP exon 4 MTHFR 1 (1/0/0) YES NO
ALDH2 *1*2 allele others ALDH2 1 (0/1/0) NO NO
HTR3B IVS4+12G>A point mutation HTR3B 1 (0/1/0) YES NO
SLC6A3 I13+1457 point mutation SLC6A3 1 (1/0/0) NO NO
MTHFR exon 7 A1298C SNP exon 7 MTHFR 1 (1/0/0) YES NO
ALG9 D11S5025 microsatellite ALG9 1 (0/1/0) NO NO
HTR3B IVS6+72A>G point mutation HTR3B 1 (0/1/0) YES NO
SLC6A3 I14+4217 point mutation SLC6A3 1 (0/1/0) NO NO
GRM7 3 6900524 1000G deletion Promoter GRM7 1 (0/1/0) NO NO
ALG9 D11S5026 microsatellite ALG9 1 (0/1/0) NO NO
HTR4 IVS1+15T/C point mutation HTR4 1 (0/1/0) YES YES
SLC6A3 I5+448 point mutation SLC6A3 1 (0/1/0) NO NO
GRM7 3 6901914 1000G deletion Promoter GRM7 1 (0/1/0) NO NO
ALG9 D11S5027 microsatellite ALG9 1 (0/1/0) NO NO
HTR4 IVS3+63C/T point mutation HTR4 1 (0/1/0) YES YES
SLC6A3 I7+922 point mutation SLC6A3 1 (0/1/0) NO NO
GRM7 3 6902624 1000G insertion Promoter GRM7 1 (0/1/0) NO NO
ALG9 D11S5028 microsatellite ALG9 1 (0/1/0) NO NO
HTR4 IVS3+6G/A point mutation HTR4 1 (0/1/0) YES YES
SLC6A3 I8+2086 point mutation SLC6A3 1 (1/0/0) NO NO
GRM7 3f 7313045 point mutation Promoter of ENST00000463676 isoform GRM7 1 (0/1/0) NO NO
ALOX12 R261Q point mutation ALOX12 1 (1/0/0) NO NO
HTR4 IVS4+36T/C point mutation HTR4 1 (0/1/0) YES YES
SLC6A3 P+2459 point mutation SLC6A3 1 (0/1/0) NO NO
GRM7 nPb 7467774 point mutation Promoter of ENST00000458641 isoform GRM7 1 (0/1/0) NO NO
alpha8-alpha10 del insertion/deletion 16.7-kb deletion affecting PCDH-alpha exons 8-10 5q31-linked PCDH family 1 (0/1/0) YES NO
HTR4 SVRSNP1 point mutation HTR4 1 (1/0/0) YES YES
SLC6A4 3'UTR G/T point mutation 3'UTR SLC6A4 1 (0/1/0) NO NO
GRM7 nPa 7493030 indel Promoter of ENST00000458641 isoform GRM7 1 (0/1/0) NO NO
APOE e3/e4 point mutation APOE 1 (1/0/0) NO NO
HTR4 SVRSNP2 point mutation HTR4 1 (1/0/0) YES YES
SLC6A5 AC-tandem-repeat microsatellite SLC6A5 1 (0/1/0) YES NO
GRM7 nex4 7600830 indel Exon of ENST00000458641 isoform GRM7 1 (0/1/0) NO NO
ATP1A3 2-7 allele others ATP1A3 1 (1/0/0) NO NO
HTR4 SVRSNP3 point mutation HTR4 1 (1/0/0) YES YES
SNAP25 promoter SNP1 point mutation promoter SNAP25 1 (0/1/0) NO NO
GRM7 nex7 7649745 insertion Exon of ENST00000458641 isoform GRM7 1 (0/1/0) NO NO
ATP1B3 4E12 microsatellite ATP1B3 1 (0/1/0) NO NO
HTR4 SVRSNP4 point mutation HTR4 1 (1/0/0) YES YES
SNAP29 exon1 56T>C point mutation exon1 SNAP29 1 (0/1/0) YES NO
GRM7 nex8 7678357 point mutation Exon of ENST00000458641 isoform GRM7 1 (0/1/0) NO NO
ATP2A2 exon15 2172G/A point mutation exon15 ATP2A2 1 (0/1/0) NO NO
HTR5A 12A/T point mutation HTR5A 1 (0/1/0) NO YES
SNAP29 exon1 92A>G point mutation exon1 SNAP29 1 (0/1/0) YES NO
GRM7 9c 7698252 point mutation Exon 9 3' UTR GRM7 1 (0/1/0) NO NO
ATP2A2 exon15 2295G/A point mutation exon15 ATP2A2 1 (0/1/0) NO NO
HTR5A 19G/C point mutation HTR5A 1 (0/1/0) NO YES
SNAP29 promoter -849G>A point mutation promoter SNAP29 1 (0/1/0) YES NO
STR Simple T repeat Exon 9 3' UTR GRM7 1 (0/1/0) NO NO
ATP2A2 exon18 2697G/T point mutation exon18 ATP2A2 1 (0/1/0) NO NO
HTR6 126G/T point mutation HTR6 1 (0/1/0) YES NO
SOD2 Ala-9Val point mutation SOD2 1 (0/1/0) NO YES
GRM7 Ex14 Indel insertion Exon 14 GRM7 1 (0/1/0) NO NO
ATP2A2 exon1 87C/T point mutation exon1 ATP2A2 1 (0/1/0) NO NO
SSTR5 -2134delT insertion/deletion SSTR5 1 (0/1/0) NO NO
TACR1 ss825678898 insertion/deletion TACR1 1 (0/1/0) NO NO
ATP2A2 intron3 220-18G/A point mutation intron3 ATP2A2 1 (0/1/0) NO NO
HTR6 873+128A/C point mutation HTR6 1 (1/0/0) YES NO
SSTR5 A-1665G point mutation SSTR5 1 (0/1/0) NO NO
TACR1 Chr2:75280719:D insertion/deletion Regulatory region: ENSR00000676664; Intronic: ENST00000409848, ENST00000305249 TACR1 1 (1/0/0) NO NO
ATP2A2 promoter -2549G/A point mutation promoter ATP2A2 1 (0/1/0) NO NO
HTR6 873+30C/T point mutation HTR6 1 (0/1/0) NO NO
SSTR5 C1004T point mutation SSTR5 1 (1/0/0) NO NO
TACR1 Chr2:75327565:D insertion/deletion Regulatory region: ENSR00001543768; Intronic: ENST00000409848, ENST00000305249 TACR1 1 (1/0/0) NO NO
ATTT11 microsatellite 21q23 1 (0/1/0) NO NO
HTR7 XhoI Polymorphism SNP HTR7 1 (0/1/0) NO NO
SSTR5 C142A point mutation SSTR5 1 (1/0/0) NO NO
TACR1 Chr2:75339547:D insertion/deletion Intronic: ENST00000409848, ENST00000305249 TACR1 1 (1/0/0) NO NO
BDNF 11757C/G point mutation BDNF 1 (1/0/0) NO NO
IFNG 874T/A point mutation IFNG 1 (1/0/0) NO NO
SSTR5 C155T point mutation SSTR5 1 (0/1/0) NO NO
TACR1 Chr2:75359623:D insertion/deletion Intronic: ENST00000409848, ENST00000305249 TACR1 1 (1/0/0) NO NO
BDNF 12910C/A point mutation BDNF 1 (0/1/0) NO NO
IGF1 (CA)n microsatellite IGF1 1 (1/0/0) NO NO
SSTR5 C325T point mutation SSTR5 1 (0/1/0) NO NO
chr2:75561695:D insertion/deletion Intergenic variant 1 (1/0/0) NO NO
BDNF -1360C>T point mutation BDNF 1 (0/1/0) NO NO
IL10 1082G/A point mutation IL10 1 (0/1/0) NO YES
SSTR5 C633T point mutation SSTR5 1 (0/1/0) NO NO
chr2:75618722:I insertion/deletion Intergenic variant 1 (1/0/0) NO NO
BDNF 14569G/A point mutation BDNF 1 (1/0/0) NO NO
SSTR5 C-801G point mutation SSTR5 1 (0/1/0) NO NO
EVA1A chr2:75693696:D insertion/deletion Downstream of ENST00000485891, ENST00000490746 EVA1A 1 (1/0/0) NO NO
BDNF -1480C/G point mutation BDNF 1 (0/1/0) NO NO
IL6 174G/C point mutation IL6 1 (0/1/0) NO NO
SSTR5 G573A point mutation SSTR5 1 (1/0/0) NO NO
rs63470962 insertion GRM7 1 (0/1/0) NO NO
IMPA2 159T>C point mutation IMPA2 1 (1/0/0) NO NO
SSTR5 T-2187G point mutation SSTR5 1 (0/1/0) NO NO
rs113329024 insertion CACNA1C 1 (0/1/0) NO NO
BDNF 3071G/A point mutation BDNF 1 (0/1/0) NO NO
SSTR5 T-461C point mutation SSTR5 1 (0/1/0) NO NO
MIR137/MIR2682 Chr1:98515539 A/T point mutation Enhancer MIR137, MIR2682 1 (1/0/0) YES NO
BDNF -633T/A point mutation BDNF 1 (1/0/0) NO NO
SLC1A2 Chr1:35441380 G/C point mutation Putative promoter SLC1A2 1 (0/1/0) NO NO
BDNF 9202G/A point mutation BDNF 1 (0/1/0) NO NO
IMPA2 230+141G>A point mutation IMPA2 1 (0/1/0) NO NO
SYNGR1 exon3 Ser97Ser point mutation exon3 SYNGR1 1 (1/0/0) YES NO
SLC1A2 Chr1:35440927 A/G point mutation 5'-UTR SLC1A2 1 (0/1/0) NO NO
BDNF A-633T point mutation BDNF 1 (0/1/0) NO NO
IMPA2 -241 -237dup duplication IMPA2 1 (0/1/0) NO NO
SYNGR1 exon6 Asn(ins/del) insertion/deletion exon6 SYNGR1 1 (0/1/0) YES NO
SLC1A2 Chr1:35440635 G/A point mutation 5'-UTR SLC1A2 1 (0/1/0) NO NO
BDNF C270T point mutation BDNF 1 (0/1/0) NO NO
IMPA2 382-44G>A point mutation IMPA2 1 (0/1/0) NO NO
SYNJ1 intron12 IVS12+15delT,+17delT insertion/deletion intron12 SYNJ1 1 (0/1/0) NO NO
SLC1A2 Chr1:35440563 C/G point mutation 5'-UTR SLC1A2 1 (0/1/0) NO NO
BDNF (CA) microsatellite 1.3 kb away from rs6265 BDNF 1 (0/1/0) NO NO
SYNJ1 IVS12+15delT,+17delT insertion/deletion SYNJ1 1 (0/1/0) NO NO
SLC1A2 Chr1:35344202 G/T point mutation Exonic p.(A20S) 5'-UTR SLC1A2 1 (0/1/0) YES NO
BDNF g.11757C>G point mutation BDNF 1 (0/1/0) NO NO
SYNJ1 IVS28-7G/T point mutation SYNJ1 1 (0/1/0) NO NO
SLC1A2 Chr1:35339061 C/T point mutation Exonic p.(A7V) SLC1A2 1 (0/1/0) YES NO
IMPA2 490+13 14insA insertion/deletion IMPA2 1 (0/1/0) NO NO
SYNJ1 IVS29+14C/T point mutation SYNJ1 1 (0/1/0) NO NO
SLC1A2 Chr1:35282452 C/T point mutation Exonic p.(R572C) SLC1A2 1 (0/1/0) YES NO
BDNF hCV11592756 point mutation BDNF 1 (1/0/0) NO NO
IMPA2 599+97G>A point mutation IMPA2 1 (0/1/0) NO NO
SYNJ1 K295R point mutation SYNJ1 1 (0/1/0) NO NO
SLC1A2 Chr1:35279202 A/G point mutation 3'-UTR SLC1A2 1 (0/1/0) NO NO
IMPA2 599+99G>A point mutation IMPA2 1 (0/1/0) NO NO
TBP CAG/CAA repeats microsatellite TBP 1 (0/1/0) NO NO
IL1B Chr2:113304498 Exonic IL1B 1 (0/0/1) NO NO
IMPA2 -708G>A point mutation IMPA2 1 (0/1/0) YES NO
TBX1 v14186 point mutation TBX1 1 (0/1/0) YES YES
IL36RN Chr2:113536607 Exonic IL36RN 1 (0/0/1) NO NO
C21ORF2 insertion/deletion 21q23 1 (0/1/0) NO NO
TCF4 CAG/CTG repeat microsatellite TCF4 1 (0/1/0) NO NO
IL1RN Chr2:113594121 Intronic, Exonic IL1RN 1 (0/0/1) NO NO
CAP2 triplet repeat microsatellite CAP2 1 (0/1/0) NO NO
IMPA2 IVS1-15G>A point mutation IMPA2 1 (0/1/0) YES NO
ACTR3 Chr2:114401422 Exonic ACTR3 1 (0/0/1) NO NO
CCK STR microsatellite CCK 1 (0/1/0) NO YES
IMPA2 IVS5+13-14InsA insertion/deletion IMPA2 1 (0/1/0) YES NO
TH 1-5 allele others TH 1 (0/1/0) NO YES
DPP10 Chr2:116251310 Exonic DPP10 1 (0/0/1) NO NO
CD18-AciI microsatellite 21q22.3 1 (0/1/0) NO NO
INPP1 C973A point mutation INPP1 1 (0/1/0) NO NO
DPP10 Chr2:116314867 Exonic DPP10 1 (0/0/1) NO NO
CHRFAM7A 2bp deletion insertion/deletion CHRFAM7A 1 (0/1/0) YES NO
INS PvuII Polymorphism SNP INS 1 (0/1/0) NO NO
TH BglII RFLP TH 1 (1/0/0) NO NO
PTPN4 Chr2:120419158 Exonic PTPN4 1 (0/0/1) NO NO
CHRNA7 -86C/T point mutation CHRNA7 1 (0/1/0) NO NO
iPLA2 C/T point mutation PLA2G6 1 (0/1/0) NO NO
TH (CATT)n duplication TH 1 (1/0/0) NO NO
GLI2 Chr2:121444612 Exonic GLI2 1 (0/0/1) NO NO
COL6A1 VNTR 21q23 1 (0/1/0) NO NO
KAT5 BanI polymorphism point mutation KAT5 1 (0/1/0) NO YES
TH intron 1 tetranucleotide polymorphism others intron 1 TH 1 (0/1/0) NO NO
GLI2 Chr2:121464518 Exonic GLI2 1 (0/0/1) NO NO
COMT C256G SNP COMT 1 (0/1/0) NO NO
KCNN3 CAG/CTG repeat microsatellite 1q21.3 KCNN3 1 (0/1/0) NO NO
ZHX1 Chr8:124336277 Intronic, Exonic, ncRNA ZHX1-C8orf76, ZHX1 1 (0/0/1) NO NO
COMT Codon108/158 point mutation COMT 1 (0/1/0) NO NO
ZHX1 Chr8:124336599 Intronic, Exonic, ncRNA ZHX1-C8orf76, ZHX1 1 (0/0/1) NO NO
COMT G/A point mutation COMT 1 (1/0/0) NO YES
KCNQ2 3'end 30-15/54 point mutation 3'end KCNQ2 1 (0/1/0) NO NO
ATAD2 Chr8:124419211 Exonic ATAD2 1 (0/0/1) NO NO
KCNQ2 3'end 30-84/37 point mutation 3'end KCNQ2 1 (0/1/0) NO NO
ATAD2 Chr8:124440660 Exonic ATAD2 1 (0/0/1) NO NO
COMT NlaIII point mutation COMT 1 (1/0/0) NO NO
KCNQ2 5'end 4/30/1958 point mutation 5'end KCNQ2 1 (0/1/0) NO NO
TH (TCAT)n microsatellite TH 1 (0/1/0) YES NO
ATAD2 Chr8:124451340 Exonic ATAD2 1 (0/0/1) NO NO
COMT P2 promoter -278A/G point mutation P2 promoter COMT 1 (0/1/0) NO NO
KCNQ2 Intron12 7/30/1930 point mutation Intron12 KCNQ2 1 (1/0/0) NO NO
TH tetranucleotide repeat tetranucleotide repeat TH 1 (0/1/0) NO NO
FBXO32 Chr8:124614644 Exonic FBXO32 1 (0/0/1) NO NO
KCNQ2 Intron 30-2/62 point mutation Intron KCNQ2 1 (1/0/0) NO NO
TH VNTR VNTR TH 1 (0/1/0) NO NO
TRIB1 Chr8:126514759 Exonic TRIB1 1 (0/0/1) NO NO
cPLA2 BanI dimorphic site point mutation KAT5 1 (0/1/0) NO NO
KCNQ2 Intron4 30-17/37 point mutation Intron4 KCNQ2 1 (0/1/0) NO NO
ATP6V0A2 TJ6 GC24E19A point mutation ATP6V0A2 1 (0/1/0) NO NO
MYC Chr8:128819709 Exonic MYC 1 (0/0/1) NO NO
CRH polymorphisms VNTR CRH 1 (0/1/0) NO NO
KIAA1595 GC29E04A point mutation DDX55 1 (0/1/0) NO NO
TMEM1 microsatellite microsatellite 21q22.3 TRAPPC10 1 (0/1/0) NO NO
DYNC1H1 Chr14:101530331 Exonic DYNC1H1 1 (0/0/1) NO NO
CRHR2 1047G/A point mutation CRHR2 1 (0/1/0) NO YES
KIAA1595 GC29E06A point mutation DDX55 1 (1/0/0) NO NO
TNF-alpha 308G/A point mutation TNF 1 (1/0/0) NO NO
DYNC1H1 Chr14:101533297 Exonic DYNC1H1 1 (0/0/1) NO NO
CRHR2 intron10 (GAT)n microsatellite intron10 CRHR2 1 (1/0/0) NO NO
KIAA1595 GC29E08A point mutation DDX55 1 (0/1/0) NO NO
HSP90AA1 Chr14:101622401 Exonic HSP90AA1 1 (0/0/1) NO NO
CRHR2 intron10 (GT)n microsatellite intron10 CRHR2 1 (0/1/0) NO NO
KNTC1 GC07E08A point mutation KNTC1 1 (0/1/0) NO NO
TPH1 3'UTR A27237G point mutation 3'UTR TPH1 1 (0/1/0) NO NO
RCOR1 Chr14:102250649 Exonic RCOR1 1 (0/0/1) NO NO
CRHR2 intron4 (CA)n microsatellite intron4 CRHR2 1 (0/1/0) NO NO
KNTC1 GC07E25A point mutation KNTC1 1 (0/1/0) NO NO
TPH1 5'flanking A-1067G point mutation 5'flanking TPH1 1 (0/1/0) NO NO
MARK3 Chr14:102985013 Exonic MARK3 1 (0/0/1) NO NO
CUX2 1191C/T point mutation CUX2 1 (0/1/0) NO NO
KNTC1 GC07E57A point mutation KNTC1 1 (0/1/0) NO NO
TPH1 5'flanking G-347T point mutation 5'flanking TPH1 1 (0/1/0) NO NO
MARK3 Chr14:103002170 Exonic MARK3 1 (0/0/1) NO NO
CUX2 2607G/C point mutation CUX2 1 (0/1/0) NO NO
LEPR hcv518168 point mutation LEPR 1 (1/0/0) NO NO
TPH1 5'flanking T-1721G point mutation 5'flanking TPH1 1 (0/1/0) NO NO
KLC1 Chr14:103193796 Exonic KLC1 1 (0/0/1) NO NO
CUX2 277G/A point mutation CUX2 1 (0/1/0) NO NO
LNX1 SNP A-1948953 point mutation LNX1 1 (1/0/0) NO NO
KLC1 Chr14:103193859 Exonic KLC1 1 (0/0/1) NO NO
CUX2 3732T/C point mutation CUX2 1 (0/1/0) NO NO
LOC100507206 1634tet microsatellite LOC100507206 1 (1/0/0) NO NO
TDRD9 Chr14:103464808 Exonic TDRD9 1 (0/0/1) NO NO
D18S453 microsatellite 18p11.2 1 (1/0/0) YES NO
LOC100507206 29818-insT point mutation LOC100507206 1 (1/0/0) NO NO
TPH1 promoter 218A/C point mutation promoter TPH1 1 (0/1/0) NO NO
TDRD9 Chr14:103576402 Exonic TDRD9 1 (0/0/1) NO NO
D1 EcoR1 SNP DRD1 1 (0/1/0) NO NO
LOC100507206 307CA1 microsatellite LOC100507206 1 (1/0/0) NO NO
TPH2 C2755A point mutation TPH2 1 (1/0/0) NO NO
BRF1 Chr14:104763646 Exonic BRF1 1 (0/0/1) NO NO
D1S243 microsatellite PRKCZ 1 (1/0/0) NO NO
LOC100507206 307CA2 microsatellite LOC100507206 1 (1/0/0) NO NO
TPH2 promoter 703G/T point mutation promoter TPH2 1 (0/1/0) NO NO
PACS2 Chr14:104904668 Exonic PACS2 1 (0/0/1) NO NO
D1 Taq1 SNP DRD1 1 (0/1/0) NO NO
LOC100507206 307GT4 microsatellite LOC100507206 1 (1/0/0) NO NO
TPH1 BfaI Polymorphism SNP TPH1 1 (0/1/0) NO NO
MTA1 Chr14:105007547 Exonic, 3'UTR MTA1 1 (0/0/1) NO NO
D21S1260 microsatellite 21q22.3 1 (1/0/0) NO NO
LOC100507206 D12S1634 microsatellite LOC100507206 1 (1/0/0) NO NO
TRPM2 c.2363C>T point mutation exon15 TRPM2 1 (0/1/0) NO NO
NDE1 Chr16:15785033 C/G missense Exon 7 NDE1 1 (0/1/0) YES NO
D21s1411 microsatellite 21q22.3 1 (0/1/0) NO NO
LOC100507206 D12S2075 microsatellite LOC100507206 1 (1/0/0) NO NO
TRPM2 c.2890+55A>G point mutation intron18 TRPM2 1 (0/1/0) NO NO
NDE1 Chr16:15785118 C/T missense Exon 7 NDE1 1 (0/1/0) YES NO
D21S171 microsatellite 21q22.3 1 (1/0/0) NO NO
LOC100507206 D12S307 microsatellite LOC100507206 1 (1/0/0) NO NO
TRPM2 c.3205C>T point mutation exon20 TRPM2 1 (0/1/0) NO NO
NDE1 Chr16:15785177 C/T missense Exon 7 NDE1 1 (1/0/0) YES NO
D21S1897 microsatellite 21q22.3 1 (0/1/0) NO NO
LOC100507206 D12SDK1 microsatellite LOC100507206 1 (1/0/0) NO NO
TRPM2 c.3246+68C>T point mutation intron20 TRPM2 1 (0/1/0) NO NO
NOS1 Exon 1c A/G point mutation Exon 1c NOS1 1 (0/1/0) NO NO
D21S1903 microsatellite 21q22.3 1 (0/1/0) NO NO
LOC100507206 pufu-in/del point mutation LOC100507206 1 (1/0/0) NO NO
TSPO exon4 Ala147Thr point mutation exon4 TSPO 1 (0/1/0) NO YES
NOS1 Exon 1f L/S Exon 1f NOS1 1 (0/1/0) NO NO
D21S212 microsatellite 21q22.3 1 (0/1/0) NO NO
MAB21L1 CAG/CTG repeat microsatellite MAB21L1 1 (0/1/0) NO NO
TSPO exon4 His162Arg point mutation exon4 TSPO 1 (0/1/0) NO YES
NOS3 Intron 4 VNTR 4a/b VNTR Intron NOS3 1 (0/1/0) NO NO
D21S266 microsatellite 21q22.3 1 (0/1/0) NO NO
MAOA 1-8 allele others MAOA 1 (0/1/0) NO NO
TYR (GA)n - (CA)n duplication TYR 1 (0/1/0) NO NO
MUC4 Chr3:195492191 C/A missense Exon MUC4 1 (0/1/0) NO NO
D22S1169 microsatellite 1 (1/0/0) YES NO
MAOA A1609G point mutation MAOA 1 (0/1/0) YES YES
uMAOA duplication promoter MAOA 1 (0/1/0) NO YES
GDNF Chr5:37812784 T/A point mutation 3'UTR GDNF 1 (0/1/0) NO NO
D22S279 microsatellite 1 (1/0/0) YES NO
VAMP2 C 25610873 10 point mutation VAMP2 1 (1/0/0) NO NO
GDNF Chr5:37812782 T/A point mutation 3'UTR GDNF 1 (0/1/0) NO NO
D22S922 microsatellite 1 (0/1/0) YES NO
MAOA exon 8 Fnu4HI Polymorphism SNP exon 8 MAOA 1 (0/1/0) NO NO
WFS1 A134A point mutation exon4 WFS1 1 (0/1/0) NO NO
GDNF Chr5:37814769 G/A point mutation 3'UTR GDNF 1 (0/1/0) NO NO
D2 Taq1 SNP DRD2 1 (0/1/0) NO NO
MAOA exon 8 RFLP SNP MAOA 1 (0/1/0) NO YES
WFS1 E737K point mutation exon8 WFS1 1 (0/1/0) NO NO
CYTH4 Promoter (GTTT)n STR Promoter CYTH4 1 (1/0/0) NO NO
D3 Msc1 SNP DRD3 1 (0/1/0) NO NO
MAOA exon 8 VNTR VNTR MAOA 1 (0/1/0) NO YES
WFS1 exon8 A1832G point mutation exon8 WFS1 1 (0/1/0) NO NO
MAOA CA point mutation MAOA 1 (1/0/0) NO NO
D5S392 microsatellite SLC6A3 1 (0/0/1) NO NO
MAOA Fnu4HI Polymorphism SNP MAOA 1 (1/0/0) NO NO
5-HT2C Cys/Ser point mutation HTR2C 1 (0/1/0) NO NO
DAOA 3'UTR SNP12 point mutation 3'UTR DAOA 1 (1/0/0) YES NO
MAOA-Fnu point mutation MAOA 1 (0/1/0) NO YES
COMT G1947A point mutation COMT 1 (0/1/0) NO YES
DAOA M12 point mutation DAOA 1 (0/1/0) YES NO
MAOA intron 1 VNTR VNTR intron 1 MAOA 1 (0/1/0) NO NO
WFS1 I720V point mutation exon8 WFS1 1 (0/1/0) NO NO
COMT C1886G point mutation COMT 1 (1/0/0) NO YES
DAOA M23 point mutation DAOA 1 (1/0/0) YES NO
MAOA intron 2 dinucleotide repeat duplication intron 2 MAOA 1 (0/1/0) NO NO
WFS1 I823I point mutation exon8 WFS1 1 (0/1/0) NO NO
DAOA M24 point mutation DAOA 1 (0/1/0) YES NO
MAOA LPR VNTR MAOA 1 (0/1/0) YES YES
WFS1 K811K point mutation exon8 WFS1 1 (0/1/0) NO NO
DAOA z6:1117 point mutation DAOA 1 (0/1/0) NO NO
WFS1 N500N point mutation exon8 WFS1 1 (0/1/0) NO NO
DAO MDAAO4 point mutation DAO 1 (0/1/0) YES NO
WFS1 R456H point mutation exon8 WFS1 1 (0/1/0) NO NO
DAO MDAAO5 point mutation DAO 1 (0/1/0) YES NO
WFS1 S855S point mutation exon8 WFS1 1 (0/1/0) NO NO
DAO MDAAO6 point mutation DAO 1 (0/1/0) YES NO
WFS1 SNP1023 point mutation WFS1 1 (0/1/0) NO YES
WFS1 SNP1185 point mutation WFS1 1 (0/1/0) NO YES
DAT E15+1812T/C point mutation SLC6A3 1 (0/1/0) NO NO
MAOB 1-12 allele others MAOB 1 (1/0/0) NO NO
WFS1 SNP1645 point mutation WFS1 1 (0/1/0) NO YES
DAT E15+274G/C point mutation SLC6A3 1 (0/1/0) NO NO
WFS1 SNP1832 point mutation WFS1 1 (0/1/0) NO YES
DAT E15+352G/A point mutation SLC6A3 1 (0/1/0) NO NO
MCP-1 A-2518G point mutation CCL2 1 (0/1/0) NO NO
WFS1 SNP2206 point mutation WFS1 1 (0/1/0) NO YES
DAT I10+117G/A point mutation SLC6A3 1 (0/1/0) NO NO
MDR1 exon26 C3435T point mutation exon 26 ABCB1 1 (1/0/0) NO NO
WFS1 SNP2565 point mutation WFS1 1 (0/1/0) NO YES
DAT I6+96G/C point mutation SLC6A3 1 (0/1/0) NO NO
MED12 exon42 duplication duplication exon42 MED12 1 (0/1/0) YES NO
WFS1 SNP684 point mutation WFS1 1 (1/0/0) NO YES
DAT I9-21G/A point mutation SLC6A3 1 (0/1/0) NO NO
MMP3 1171 5A/6A insertion/deletion MMP3 1 (0/1/0) YES NO
WFS1 SNP935 point mutation WFS1 1 (0/1/0) NO YES
DAT P+214A/G point mutation SLC6A3 1 (0/1/0) NO NO
mtDNA 12358A>G point mutation mtDNA 1 (1/0/0) NO NO
WFS1 V395V point mutation exon8 WFS1 1 (0/1/0) NO NO
mtDNA 3644T>C point mutation mtDNA 1 (1/0/0) NO NO
WFS1 V503G point mutation exon8 WFS1 1 (0/1/0) NO NO
DBH A304S point mutation DBH 1 (0/1/0) NO NO
mtDNA 5460G>A point mutation mtDNA 1 (0/1/0) NO NO
White PolyT microsatellite 21q22.3 1 (0/1/0) NO NO
uVNTR MAOA MAOA 1 (0/1/0) NO NO
rs1137070 c.1460 C/T c.1460 in MAOA exon 14 MAOA 1 (1/0/0) NO NO
mtDNA A9115G point mutation mtDNA 1 (0/1/0) NO NO
YWHAH 5'UTR (GCCTGCA)n duplication 5'UTR YWHAH 1 (1/0/0) NO NO
MAOA-CA MAOA in intron 2 of MAOA MAOA 1 (1/0/0) NO NO
DDC microsatellite polymorphisms microsatellite DDC 1 (0/1/0) NO NO
ANK3 exon 48 P1489S point mutation exon 48 ANK3 1 (0/1/0) NO NO
MAOA-VNTR MAOA in intron 1 of MAOA MAOA 1 (0/1/0) NO NO
DISC1 1013 G>A point mutation DISC1 1 (0/0/1) NO NO
mtDNA D-loop C195T point mutation mtDNA_D-loop 1 (1/0/0) NO NO
ANK3 exon 48 T1861M point mutation exon 48 ANK3 1 (0/1/0) NO NO
rs1799835 c.941 T/G c.941 in MAOA exon 8 MAOA 1 (0/1/0) NO NO
DISC1 1253 G>A point mutation DISC1 1 (0/0/1) NO NO
mtDNA D-loop G16300A point mutation mtDNA_D-loop 1 (1/0/0) NO NO
ANK3 exon 48 E1926D point mutation exon 48 ANK3 1 (0/1/0) NO NO
rs58575285 GRIK4 1 (1/0/0) NO NO
DISC1 1700 G>A point mutation DISC1 1 (0/0/1) NO NO
mtDNA D-loop T114C point mutation mtDNA_D-loop 1 (1/0/0) NO NO
ANK3 exon 48 S2043N point mutation exon 48 ANK3 1 (0/1/0) NO NO
rs66554220 HLA-G 1 (1/0/0) NO NO
DISC1 -215(TG)8-13 others 5' upstream DISC1 1 (0/1/0) NO YES
mtDNA ND4L T10652C point mutation mtDNA_ND4L 1 (1/0/0) NO YES
ANK3 exon 48 I2158T point mutation exon 48 ANK3 1 (0/1/0) NO NO
rs458178 1 (0/1/0) NO NO
DISC1 2261 C>G point mutation DISC1 1 (0/0/1) NO NO
mtDNA T3394C point mutation mtDNA 1 (0/1/0) NO NO
ANK3 exon 48 D2319N point mutation exon 48 ANK3 1 (0/1/0) NO NO
rs3045444 ANK3 1 (0/1/0) NO NO
DISC1 2425 TCATdel insertion/deletion DISC1 1 (0/0/1) NO NO
MTHFD G1958A point mutation MTHFD1 1 (1/0/0) YES NO
ANK3 exon 48 F2375V point mutation exon 48 ANK3 1 (0/1/0) NO NO
rs10064525 SLC6A3 1 (0/1/0) NO NO
DISC1 627 C>G point mutation DISC1 1 (0/0/1) NO NO
ANK3 exon 48 S2409P point mutation exon 48 ANK3 1 (0/1/0) NO NO
rs2550240 MUC4 1 (0/1/0) NO NO
DISC1 74 G>A point mutation DISC1 1 (0/0/1) NO NO
ANK3 exon 48 N2643S point mutation exon 48 ANK3 1 (0/1/0) NO NO
rs13232194 NAPEPLD 1 (0/1/0) NO NO
DISC1 790 C>T point mutation DISC1 1 (0/0/1) NO NO
MTR A2756G point mutation MTR 1 (1/0/0) YES NO
ANK3 exon 48 R2719T point mutation exon 48 ANK3 1 (0/1/0) NO NO
DISC1 887 A>G point mutation DISC1 1 (0/0/1) NO NO
NCAM1 2208T>G point mutation NCAM1 1 (0/1/0) NO YES
ANK3 exon 48 G2845E point mutation exon 48 ANK3 1 (0/1/0) NO NO
DISC1 A844G point mutation DISC1 1 (0/1/0) YES NO
NCAM1 2256 2257 insATGG point mutation NCAM1 1 (0/1/0) NO YES
ANK3 exon 48 S2858L point mutation exon 48 ANK3 1 (0/1/0) NO NO
DISC1 C1460T point mutation DISC1 1 (0/1/0) YES NO
NCAM1 I621G>T point mutation NCAM1 1 (0/1/0) NO YES
ANK3 exon 48 Q3264K point mutation exon 48 ANK3 1 (0/1/0) NO NO
DISC1 exon2 Pro/Leu point mutation exon2 DISC1 1 (0/1/0) NO NO
NCAM1 IVS0-49de IG point mutation NCAM1 1 (0/1/0) NO YES
ANK3 exon 48 S3521G point mutation exon 48 ANK3 1 (0/1/0) NO NO
DISC1 G65049 microsatellite DISC1 1 (0/1/0) YES NO
NCAM1 IVS4+80G>C point mutation NCAM1 1 (0/1/0) NO YES
ANK3 exon 48 E3563G point mutation exon 48 ANK3 1 (0/1/0) NO NO
DISC1 IVS1+3 A>T point mutation DISC1 1 (0/0/1) NO NO
NCAM1 IVS6+32T>C point mutation NCAM1 1 (1/0/0) NO YES
ANK3 exon 48 S3697C point mutation exon 48 ANK3 1 (0/1/0) NO NO
DISC1 T11840C point mutation DISC1 1 (0/1/0) YES NO
NCAM1 IVS7+155G>T point mutation NCAM1 1 (0/1/0) NO YES
ANK3 exon 48 N3789S point mutation exon 48 ANK3 1 (0/1/0) NO NO
DISC1 T2163A point mutation DISC1 1 (0/1/0) YES NO
NCOR2 GC34E20A duplication NCOR2 1 (0/1/0) NO NO
ANK3 exon 48 K3942R point mutation exon 48 ANK3 1 (0/1/0) NO NO
DOCK9 (AAGTA) indel insertion/deletion DOCK9 1 (1/0/0) NO NO
NDUFV2 -1020G>T point mutation NDUFV2 1 (0/1/0) NO NO
DRD2/ANKK1 Taq-IA point mutation DRD2 1 (0/1/0) NO NO
DNAH14 Chr1:225586971 A/T Stoploss Chr1:225586971 DNAH14 1 (0/0/1) NO NO
NDUFV2 -2694A>G point mutation NDUFV2 1 (1/0/0) NO NO
ARV1 Chr1:231114915 A/T Missense Chr1:231114915 ARV1 1 (0/0/1) NO NO
NDUFV2 -3041T>G point mutation NDUFV2 1 (1/0/0) NO NO
SLK Chr10:105779646 C/T Missense Chr10:105779646 SLK 1 (0/0/1) NO NO
DRD1 EcoRI Polymorphism SNP DRD1 1 (0/1/0) NO NO
NDUFV2 -3245T>C point mutation NDUFV2 1 (1/0/0) NO NO
CFAP46 Chr10:134730168 G/A Missense Chr10:134730168 CFAP46 1 (0/0/1) NO NO
DRD1 RFLP SNP DRD1 1 (0/1/0) NO NO
NDUFV2 -3542G>A point mutation NDUFV2 1 (1/0/0) NO NO
CARD16 Chr11:104916205 A/G Upstream Chr11:104916205 CARD16 1 (0/0/1) NO NO
DRD2 -141CIns/Del insertion/deletion DRD2 1 (0/1/0) NO YES
ZPR1 Chr11:116652892 A/T Missense Chr11:116652892 ZNF259 1 (0/0/1) NO NO
SLU7 Chr5:159840980 T/C Missense Chr5:159840980 SLU7 1 (0/0/1) NO NO
DRD2 -151ins/del insertion/deletion DRD2 1 (0/1/0) NO NO
WWC1 Chr5:167896045 G/A others Chr5:167896045 WWC1 1 (0/0/1) NO NO
DRD2 5'flanking -141C Ins/Del insertion/deletion 5'flanking DRD2 1 (0/1/0) YES NO
SLC6A2 Gly478Ser point mutation SLC6A2 1 (0/1/0) YES NO
TAB2 Chr6:149699617 G/A Missense Chr6:149699617 TAB2 1 (0/0/1) NO NO
DRD2 (CA)n duplication DRD2 1 (0/1/0) NO NO
SLC6A2 TaqI polymorphism SNP SLC6A2 1 (0/1/0) NO NO
MTOR Chr1:11194520 C/T Splicing Chr1:11194520 MTOR 1 (0/0/1) NO NO
DRD2 intron 1 (TG)n duplication intron1 DRD2 1 (0/1/0) NO NO
SLC6A2 Thr99Ile point mutation SLC6A2 1 (0/1/0) YES NO
CASP1 Chr11:104901923 Nonframeshift del Chr11:104901923 CASP1 1 (0/0/1) NO NO
DRD2 microsatellite microsatellite DRD2 1 (1/0/0) NO YES
SLC6A2 Val245Ile point mutation SLC6A2 1 (0/1/0) YES NO
SLC25A21 Chr14:37147560 C/T others Chr14:37147560 SLC25A21 1 (0/0/1) NO NO
DRD2 polymorphism others DRD2 1 (0/1/0) NO NO
SLC6A2 Val449Ile point mutation SLC6A2 1 (0/1/0) YES NO
ID1 Chr20:30193296 T/G Missense Chr20:30193296 ID1 1 (0/0/1) NO NO
SLC6A2 Val69Ile point mutation SLC6A2 1 (0/1/0) YES NO
CDV3 Chr3:133305557 A/T Missense Chr3:133305557 CDV3 1 (0/0/1) NO NO
PITPNM2 GC18E01A point mutation PITPNM2 1 (0/1/0) NO NO
ODZ2 Chr5:167627125 C/T Missense Chr5:167627125 TENM2 1 (0/0/1) NO NO
RTN4 3'UTR CAA insertion insertion/deletion 3'UTR RTN4 1 (0/1/0) YES NO
GRN C/T point mutation GRN 1 (1/0/0) YES NO
NOS1 exon13 SNP2 point mutation exon13 NOS1 1 (0/0/1) YES NO
NOV Chr8:120430415 G/A missense point mutation Chr8:120430415 NOV 1 (0/0/1) NO NO
DRD2 (TG)n duplication DRD2 1 (1/0/0) NO NO
NOS1 exon15 IVS15+38C/T point mutation exon15 NOS1 1 (0/0/1) YES NO
INSL6 Chr9:5164252 C/T missense point mutation Chr9:5164252 INSL6 1 (0/0/1) NO NO
DRD3 allele1/allele2 others DRD3 1 (0/1/0) NO NO
NOS1 exon16 2607C/T point mutation exon16 NOS1 1 (0/0/1) YES NO
LOC285033 Chr2:96907615 A/C missense point mutation Chr2:96907615 LOC285033 1 (0/0/1) NO NO
NOS1 exon17 2712C/T point mutation exon17 NOS1 1 (0/0/1) YES NO
NCEH1 Chr3:172365793 C/T missense point mutation Chr3:172365793 NCEH1 1 (0/0/1) NO NO
DRD3 exon1 D3 polymorphism others exon1 DRD3 1 (0/1/0) NO NO
NOS1 exon17 IVS17+15A/G point mutation exon17 NOS1 1 (0/0/1) YES NO
ZAN Chr7:100382373 C/T point mutation Chr7:100382373 ZAN 1 (0/0/1) NO NO
NOS1 exon18 SNP3 point mutation exon18 NOS1 1 (0/0/1) YES NO
FAM38B Chr18:10759858 T/C point mutation Chr18:10759858 PIEZO2 1 (0/0/1) NO NO
DRD4 2-10 allele others DRD4 1 (0/1/0) NO YES
NOS1 exon19 IVS19+13T/G point mutation exon19 NOS1 1 (0/0/1) YES NO
FAM83F rs3021268 single nucleotide variation rs3021268 doesn't map to any assembly. FAM83F 1 (0/1/0) NO NO
DRD4 48bp repeat duplication DRD4 1 (0/1/0) NO NO
NOS1 exon20 137244A/G point mutation exon20 NOS1 1 (0/0/1) YES NO
ANK3 Chr10:61786761 A/G point mutation ANK3 1 (0/1/0) NO NO
NOS1 exon21 3258C/T point mutation exon21 NOS1 1 (0/0/1) YES NO
ANK3 Chr10:61787065 TA/- insertion/deletion ANK3 1 (0/1/0) NO NO
NOS1 exon27 4063G/A point mutation exon27 NOS1 1 (0/0/1) YES NO
ANK3 Chr10:61788626 G/T point mutation 3'UTR ANK3 1 (0/1/0) NO NO
DRD4 HincII Polymorphism SNP DRD4 1 (0/1/0) NO NO
NOS1 exon27 4065G/A point mutation exon27 NOS1 1 (0/0/1) YES NO
ANK3 Chr10:61789498 AC/- insertion/deletion ANK3 1 (0/1/0) NO NO
DRD5 (CT/GT/GA)n duplication DRD5 1 (0/1/0) NO NO
NOS1 exon27 4154G/A point mutation exon27 NOS1 1 (0/0/1) YES NO
ANK3 Chr10:61789512 C/- insertion/deletion ANK3 1 (0/1/0) NO NO
DRD5 D4S615 microsatellite DRD5 1 (0/1/0) YES YES
NOS1 exon27 IVS27+14T/G point mutation exon27 NOS1 1 (0/0/1) YES NO
ANK3 Chr10:61789556 C/- insertion/deletion ANK3 1 (0/1/0) NO NO
G'>DRP2 5'-flanking -975C>G point mutation 5'flanking DRP2 1 (0/1/0) NO NO
NOS1 exon27 IVS27+9C/A point mutation exon27 NOS1 1 (0/0/1) YES NO
ANK3 Chr10:61819783 T/G point mutation ANK3 1 (0/1/0) NO NO
DRP2 exon13 1506T>C point mutation exon13 DRP2 1 (0/1/0) NO NO
NOS1 exon27 SNP5 point mutation exon27 NOS1 1 (0/0/1) YES NO
ANK3 Chr10:61841574 T/- insertion/deletion ANK3 1 (0/1/0) NO NO
DRP2 exon14 *2236T>C point mutation exon14 DRP2 1 (0/1/0) NO NO
NOS1 exon29 SNP4 point mutation exon29 NOS1 1 (0/0/1) YES NO
ANK3 Chr10:61843365 C/G point mutation ANK3 1 (0/1/0) NO NO
DRP2 exon4 352G>A point mutation exon4 DRP2 1 (0/1/0) NO NO
NOS1 exon7 IVS7-15C/G point mutation exon7 NOS1 1 (0/0/1) YES NO
ANK3 Chr10:61900256 G/A point mutation ANK3 1 (0/1/0) NO NO
DRP2 exon4 426C>T point mutation exon4 DRP2 1 (0/1/0) NO NO
ANK3 Chr10:61900727 G/C point mutation ANK3 1 (0/1/0) NO NO
DUSP6 exon1 Leu111Val point mutation exon1 DUSP6 1 (0/1/0) NO YES
NOS1 SNP1 point mutation NOS1 1 (0/1/0) YES NO
ANK3 Chr10:61900857 G/A point mutation ANK3 1 (0/1/0) NO NO
DUSP6 Leu114Val point mutation DUSP6 1 (0/1/0) NO YES
NOS3 G894T point mutation NOS3 1 (0/1/0) NO YES
ANK3 Chr10:61901317 -/TG insertion/deletion ANK3 1 (0/1/0) NO NO
ERBB4 SNV7 G>A point mutation ERBB4 1 (1/0/0) NO NO
NOS3 Intron4 VNTR VNTR Intron4 NOS3 1 (0/1/0) NO YES
ANK3 Chr10:61901321 T/G point mutation ANK3 1 (0/1/0) NO NO
ERBB4 SNV8 A insertion/deletion insertion/deletion ERBB4 1 (0/1/0) NO NO
NOS3 T-786C point mutation NOS3 1 (0/1/0) NO YES
ANK3 Chr10:61941143 C/G point mutation ANK3 1 (0/1/0) NO NO
ERDA1 CAG/CTG repeat microsatellite ERDA1 1 (0/1/0) NO NO
ANK3 Chr10:61958307 G/T point mutation ANK3 1 (0/1/0) NO NO
NOTCH4 promoter A>G point mutation promoter NOTCH4 1 (0/1/0) NO NO
ANK3 Chr10:62149642 C/T point mutation ANK3 1 (0/1/0) NO NO
FEZ1 IVS3+2509C>T point mutation FEZ1 1 (0/1/0) YES NO
NQO1 C609T point mutation NQO1 1 (0/1/0) NO YES
ANK3 Chr10:62150190 G/A point mutation ANK3 1 (0/1/0) NO NO
FEZ1 IVS4+1077T>C point mutation FEZ1 1 (0/1/0) YES NO
NR2E1 g. -1429 point mutation NR2E1 1 (0/1/0) YES NO
ANK3 Chr10:62332894 -/A insertion/deletion ANK3 1 (0/1/0) NO NO
FEZ1 IVS9+66A>T point mutation FEZ1 1 (0/1/0) YES NO
ANK3 Chr10:62332895 A/AA duplication ANK3 1 (0/1/0) NO NO
FLJ11021 GC6E04A point mutation RSRC2 1 (0/1/0) NO NO
ANK3 Chr10:62332985 T/- insertion/deletion ANK3 1 (0/1/0) NO NO
FLJ22471 GC32E03A point mutation CCDC92 1 (0/1/0) NO NO
NRG1 D8S1810 microsatellite NRG1 1 (1/0/0) NO NO
ANK3 Chr10:62333120 ACCAACCA/- insertion/deletion ANK3 1 (0/1/0) NO NO
FLJ22471 GC32E04A point mutation CCDC92 1 (1/0/0) NO NO
NRG1 exon 11 Val>Leu point mutation exon 11 1 (0/1/0) YES NO
ANK3 Chr10:62493812 G/C point mutation ANK3 1 (0/1/0) NO NO
GABRA1 -181A/G point mutation GABRA1 1 (0/1/0) NO YES
NRG1 SNP88NR221533 point mutation NRG1 1 (0/1/0) NO NO
ANK3 Chr10:62494029 A/G point mutation ANK3 1 (0/1/0) NO NO
GABRA1 -471T/C point mutation GABRA1 1 (0/1/0) NO YES
NRG1 SNP8NRG221132 point mutation NRG1 1 (0/1/0) YES NO
ANK3 Chr10:62494113 C/T point mutation ANK3 1 (0/1/0) NO NO
GABRA1 IVS2-712(GT)n microsatellite GABRA1 1 (1/0/0) NO YES
ANK3 Chr10:62494201 CT/CTATATTAT insertion/deletion ANK3 1 (0/1/0) NO NO
GABRA1 IVS9+76A/G point mutation GABRA1 1 (0/1/0) NO YES
CACNA1C Chr12:2161733 G/C point mutation CACNA1C 1 (0/1/0) NO NO
GABRA3 (AC)n duplication GABRA3 1 (0/1/0) NO NO
CACNA1C Chr12:2161930 C/T point mutation CACNA1C 1 (0/1/0) NO NO
GABRA3 CA repeat microsatellite GABRA3 1 (1/0/0) NO NO
NTS 166C>G point mutation NTS 1 (0/1/0) NO NO
CACNA1C Chr12:2161934 G/A point mutation Promoter CACNA1C 1 (0/1/0) NO NO
GABRA3 GDB156286 VNTR GABRA3 1 (0/1/0) NO NO
NTS 3A>G point mutation NTS 1 (1/0/0) NO NO
CACNA1C Chr12:2161984 C/A point mutation CACNA1C 1 (0/1/0) NO NO
GABRA5 +11547 (CA)n microsatellite GABRA5 1 (0/1/0) NO NO
P2RX7 NBG6 microsatellite P2RX7 1 (1/0/0) NO NO
CACNA1C Chr12:2162059 -/GGGG/CGGG/AGGG insertion/deletion CACNA1C 1 (0/1/0) NO NO
GABRA5 3'UTR 1-8 allele others GABRA5 1 (1/0/0) NO YES
P2RX7 P2RX73 duplication P2RX7 1 (0/1/0) NO NO
CACNA1C Chr12:2162201 -/CGGCG insertion/deletion CACNA1C 1 (0/1/0) NO NO
GABRA5 (CA)n polymorphic dinucleotide repeat marker GABRA5 1 (1/0/0) NO YES
PCNT2-AluI microsatellite 21q22.3 1 (0/1/0) NO NO
CACNA1C Chr12:2162217 G/A point mutation CACNA1C 1 (0/1/0) NO NO
GABRA5 GDB162554 VNTR GABRA5 1 (1/0/0) NO NO
PENK polymorphisms VNTR PENK 1 (0/1/0) NO NO
CACNA1C Chr12:2272007 C/T point mutation CACNA1C 1 (0/1/0) NO NO
GABRb1 (GATA)n tetranucleotide repeat GABRB1 1 (1/0/0) NO NO
PER2 2087A/G point mutation PER2 1 (0/1/0) NO NO
CACNA1C Chr12:2284208 -/TGTTCAAACCTGTGT insertion/deletion CACNA1C 1 (0/1/0) NO NO
GABRB3 (CA) repeat microsatellite GABRB3 1 (0/1/0) NO NO
PER2 2114G/A point mutation PER2 1 (0/1/0) NO NO
CACNA1C Chr12:2286800 -/TCTTTCTT insertion/deletion CACNA1C 1 (0/1/0) NO NO
GABRB3 GDB160763 VNTR GABRB3 1 (0/1/0) NO NO
PER2 2117G/A point mutation PER2 1 (0/1/0) NO NO
CACNA1C Chr12:2286819 -/TT insertion/deletion CACNA1C 1 (0/1/0) NO NO
GCH1 -959G/A point mutation GCH1 1 (1/0/0) NO NO
PFKL microsatellite 21q22.3 1 (0/1/0) NO NO
CACNA1C Chr12:2286820 -/T insertion/deletion CACNA1C 1 (0/1/0) NO NO
GCLC 5'UTR repeat microsatellite 5'UTR GCLC 1 (0/1/0) NO NO
PIK3C3 -432C->T point mutation PIK3C3 1 (1/0/0) YES NO
CACNA1C Chr12:2291321 -/AT insertion/deletion CACNA1C 1 (0/1/0) NO NO
GNAL intron10 T/G point mutation intron10 GNAL 1 (0/1/0) NO NO
PIK3C3 promoter -86insC insertion/deletion promoter PIK3C3 1 (0/0/1) YES NO
CACNA1C Chr12:2292413 -/A insertion/deletion CACNA1C 1 (0/1/0) NO NO
GNAL intron3 A/G point mutation intron 3 GNAL 1 (0/1/0) NO NO
PIK4CA -31(A>G) point mutation PI4KA 1 (0/1/0) YES NO
CACNA1C Chr12:2292742 -/C insertion/deletion CACNA1C 1 (0/1/0) NO NO
GNAZ exon2 309C/T SNP exon2 GNAZ 1 (1/0/0) NO NO
PIK4CA E2079Q point mutation PI4KA 1 (0/1/0) YES NO
CACNA1C Chr12:2296694 -/T insertion/deletion CACNA1C 1 (0/1/0) NO NO
GNB3 C825T point mutation GNB3 1 (0/1/0) YES YES
PIK4CA R2259C point mutation PI4KA 1 (0/1/0) YES NO
CACNA1C Chr12:2296695 GG/TGG insertion/deletion CACNA1C 1 (0/1/0) NO NO
PIP5K2A -1007C>T point mutation PIP4K2A 1 (0/1/0) YES NO
CACNA1C Chr12:2297340 -/CT insertion/deletion CACNA1C 1 (0/1/0) NO NO
GRIN1 exon6 19700A/G point mutation exon6 GRIN1 1 (0/1/0) NO NO
PIP5K2A Exon10 1257T->G point mutation exon10 PIP4K2A 1 (0/0/1) NO NO
CACNA1C Chr12:2297530 -/CT insertion/deletion CACNA1C 1 (0/1/0) NO NO
GRIN1 intron11 6608A/G point mutation intron11 GRIN1 1 (1/0/0) NO NO
PIP5K2A Exon10 1412G->C point mutation exon 0 PIP4K2A 1 (0/0/1) NO NO
CACNA1C Chr12:2300919 -/CA insertion/deletion CACNA1C 1 (0/1/0) NO NO
GRIN1 promoter 1001G/C point mutation promoter GRIN1 1 (1/0/0) NO NO
PIP5K2A Exon10 Codon 391(GAA->GAG) point mutation exon10_codon391 PIP4K2A 1 (0/0/1) NO NO
CACNA1C Chr12:2300934 -/CTCCACAGGCACAT insertion/deletion CACNA1C 1 (0/1/0) NO NO
GRIN2A promoter (GT)n microsatellite promoter GRIN2A 1 (1/0/0) NO NO
PIP5K2A Exon5 Codon 199(GTA->GTG) point mutation exon5_codon199 PIP4K2A 1 (0/0/1) NO NO
CACNA1C Chr12:2301013 -/CACT insertion/deletion CACNA1C 1 (0/1/0) NO NO
PIP5K2A Exon7 N251S point mutation exon7 PIP4K2A 1 (0/0/1) NO NO
CACNA1C Chr12:2301016 -/T insertion/deletion CACNA1C 1 (0/1/0) NO NO
GRIN2B 366C/G point mutation GRIN2B 1 (0/1/0) NO NO
PIP5K2A Exon8 Codon 309(CCG->CCA) point mutation exon8_codon309 PIP4K2A 1 (0/0/1) NO NO
CACNA1C Chr12:2301048 -/G insertion/deletion CACNA1C 1 (0/1/0) NO NO
GRIN2B A5806C point mutation GRIN2B 1 (1/0/0) YES NO
PIP5K2A Exon8 IVS8+20C->G point mutation exon 8 PIP4K2A 1 (0/0/1) NO NO
CACNA1C Chr12:2301049 -/T insertion/deletion CACNA1C 1 (0/1/0) NO NO
GRIN2B T5988C point mutation GRIN2B 1 (1/0/0) YES NO
PIP5K2A Exon9 Intron 9 CT repeat microsatellite exon 9_intron9 PIP4K2A 1 (1/0/0) YES NO
CACNA1C Chr12:2301051 -/C insertion/deletion CACNA1C 1 (0/1/0) NO NO
GRK3 129964 SNP37 point mutation ADRBK2 1 (0/1/0) NO NO
PKNOX1 microsatellite 21q22.3 1 (0/1/0) NO NO
CACNA1C Chr12:2301188 -/ATAC/ACAC insertion/deletion CACNA1C 1 (0/1/0) NO NO
GRK3 14087 SNP23 point mutation ADRBK2 1 (1/0/0) NO NO
CACNA1C Chr12:2302620 -/A insertion/deletion CACNA1C 1 (0/1/0) NO NO
GRK3 14454 SNP24 point mutation ADRBK2 1 (0/1/0) NO NO
CACNA1C Chr12:2302621 -/A/AA insertion/deletion CACNA1C 1 (0/1/0) NO NO
GRK3 15401 SNP28 point mutation ADRBK2 1 (1/0/0) NO NO
PLA2G10 (AAT)n microsatellite PLA2G10 1 (0/1/0) NO NO
CACNA1C Chr12:2308364 -/GG insertion/deletion CACNA1C 1 (0/1/0) NO NO
GRK3 15667 SNP29 point mutation ADRBK2 1 (0/1/0) NO NO
PLCG1 exon26 C/T point mutation exon26 PLCG1 1 (0/1/0) NO NO
CACNA1C Chr12:2308644 -/C insertion/deletion CACNA1C 1 (0/1/0) NO NO
GRK3 20256 SNP32 point mutation ADRBK2 1 (0/1/0) NO NO
PLCG1 exon31 G/T point mutation exon31 PLCG1 1 (0/1/0) NO NO
CACNA1C Chr12:2314099 AAAGTATAA/- insertion/deletion CACNA1C 1 (0/1/0) NO NO
GRK3 2992 SNP14 point mutation ADRBK2 1 (0/1/0) NO NO
PLCG1 exon9 A/G point mutation exon9 PLCG1 1 (0/1/0) NO NO
CACNA1C Chr12:2314103 -/A insertion/deletion CACNA1C 1 (0/1/0) NO NO
GRK3 600 SNP12 point mutation ADRBK2 1 (0/1/0) NO NO
PON1 L55M point mutation PON1 1 (1/0/0) NO NO
CACNA1C Chr12:2317001 -/AA/AAA insertion/deletion CACNA1C 1 (0/1/0) NO NO
GRK3 9046 SNP19 point mutation ADRBK2 1 (0/1/0) NO NO
PON1 Q192R point mutation PON1 1 (1/0/0) NO NO
CACNA1C Chr12:2317010 A/C point mutation CACNA1C 1 (0/1/0) NO NO
GRK3 P-1 point mutation ADRBK2 1 (1/0/0) NO NO
PPP2R2C Intron1d 99-24169/139 point mutation Intron1d PPP2R2C 1 (1/0/0) NO NO
CACNA1C Chr12:2317010 AC/CC point mutation CACNA1C 1 (0/1/0) NO NO
GRK3 P-2 point mutation ADRBK2 1 (0/1/0) NO NO
PPP2R2C Intron4 24-247/216 point mutation Intron4 PPP2R2C 1 (1/0/0) NO NO
CACNA1C Chr12:2321310 -/C insertion/deletion CACNA1C 1 (0/1/0) NO NO
GRK3 P-5 point mutation ADRBK2 1 (1/0/0) NO NO
PPP2R2C Intron5 24-257/320 point mutation Intron5 PPP2R2C 1 (1/0/0) NO NO
CACNA1C Chr12:2323140 -/T insertion/deletion CACNA1C 1 (0/1/0) NO NO
GRK3 P-6 point mutation ADRBK2 1 (1/0/0) NO NO
PPP2R2C Intron5 99-24175/218 point mutation Intron5 PPP2R2C 1 (1/0/0) NO NO
CACNA1C Chr12:2323807 A/C point mutation CACNA1C 1 (0/1/0) NO NO
GRK3 SNP36 point mutation ADRBK2 1 (0/1/0) NO NO
PPP3CC-CC33 point mutation PPP3CC 1 (1/0/0) NO NO
CACNA1C Chr12:2328828 A/T point mutation CACNA1C 1 (0/1/0) NO NO
GRM3 +1131C/T point mutation GRM3 1 (0/1/0) YES NO
PPP3CC-CCS3 point mutation PPP3CC 1 (1/0/0) NO NO
CACNA1C Chr12:2329069 G/T point mutation intron CACNA1C 1 (0/1/0) NO NO
GRM7 hcv11751218 point mutation GRM7 1 (1/0/0) NO NO
PRKCZ(AC)24 microsatellite PRKCZ 1 (0/1/0) NO NO
CACNA1C Chr12:2332571 T/- insertion/deletion CACNA1C 1 (0/1/0) NO NO
PRKCZ(CA)13 microsatellite PRKCZ 1 (0/1/0) NO NO
CACNA1C Chr12:2334223 -/G insertion/deletion CACNA1C 1 (0/1/0) NO NO
PRKCZ(GT)17 microsatellite PRKCZ 1 (0/1/0) NO NO
CACNA1C Chr12:2335287 -/CG insertion/deletion CACNA1C 1 (0/1/0) NO NO
GSTM1 positive/null insertion/deletion GSTM1 1 (1/0/0) NO NO
PRODH-1482 point mutation PRODH 1 (0/1/0) YES NO
CACNA1C Chr12:2335288 -/CG/CGCG insertion/deletion CACNA1C 1 (0/1/0) NO NO
GSTT1 positive/null insertion/deletion GSTT1 1 (0/1/0) NO NO
PRODH-1945 point mutation PRODH 1 (0/1/0) YES NO
CACNA1C Chr12:2335298 -/A/C insertion/deletion CACNA1C 1 (0/1/0) NO NO
16p11.2 microduplications duplication 0 (0/0/0) NO NO
SLC1A2 Chr11:35441380 G/C Chr11:35441380 SLC1A2 0 (0/0/0) NO NO
SLC1A2 Chr11:35441311 G/A Chr11:35441311 SLC1A2 0 (0/0/0) NO NO
MAOA microsatellite polymorphisms microsatellite MAOA 0 (0/0/0) NO NO
SLC1A2 Chr11:35441254 C/T Chr11:35441254 SLC1A2 0 (0/0/0) NO NO
SLC1A2 Chr11:35440927 A/G Chr11:35440927 SLC1A2 0 (0/0/0) NO NO
SLC1A2 Chr11:35440635 G/A Chr11:35440635 SLC1A2 0 (0/0/0) NO NO
SLC1A2 Chr11:35440563 C/G Chr11:35440563 SLC1A2 0 (0/0/0) NO NO
SLC1A2 Chr11:35440498 G/A Chr11:35440498 SLC1A2 0 (0/0/0) NO NO
SLC1A2 Chr11:35344202 G/T Chr11:35344202 SLC1A2 0 (0/0/0) NO NO
SLC1A2 Chr11:35344107 G/A Chr11:35344107 SLC1A2 0 (0/0/0) NO NO
SLC1A2 Chr11:35339061 C/T Chr11:35339061 SLC1A2 0 (0/0/0) NO NO
SLC1A2 Chr11:35338989 G/A Chr11:35338989 SLC1A2 0 (0/0/0) NO NO
SLC1A2 Chr11:35282452 C/T Chr11:35282452 SLC1A2 0 (0/0/0) NO NO
SLC1A2 Chr11:35280227 C/T Chr11:35280227 SLC1A2 0 (0/0/0) NO NO
SLC1A2 Chr11:35279202 A/G Chr11:35279202 SLC1A2 0 (0/0/0) NO NO
SLC1A2 Chr11:35276479 C/T Chr11:35276479 SLC1A2 0 (0/0/0) NO NO

Copyright: Bioinformatics Lab, Institute of Psychology, Chinese Academy of Sciences Feedback Acknowledgements
To view this website normally, please make sure to allow Flash to run from the local filesystem in the security settings panel.
Last update: March 31, 2016