BDgene

Gene Report

Basic Info
Approved Symbol CACNA1C
Previous Symbol CCHL1A1, CACNL1A1
Symbol Alias Cav1.2, CACH2, CACN2, TS, LQT8
Approved Name calcium channel, voltage-dependent, L type, alpha 1C subunit
Location 12p13.3
Position chr12:1970786-2697950, 1
External Links HGNC: 1390
Entrez Gene: 775
Ensembl: ENSG00000151067
UCSC: uc001qjy.3
No. of Studies 20 (Positive: 17; Negative: 3; trend: 0)
Overlap with SZ? YES
Overlap with MDD? YES
Gene related studies (count: 20)
Reference Tested Markers Statistical Values/Author Comments Result Category Comment on Study
Ament, S. A., 2015 Coding P-value=0.038, q-value=0.22, Regulatory P-value<1.0e-5, q-value=0.00026. The gene has significant rare variant associations to BD. Positive Comment on Study
Ruderfer, D. M., 2013 SNP: rs1006737 The most significant SNP falls within the gene CACNA1C that was first found to be significant in BP, subsequently in SCZ. Positive Comment on Study
Zhang X, 2013 SNP: rs723672, rs215976, rs1051375 Our initial findings support a potential association of CACNA1C as a genetic risk factor for BD susceptibility. Positive Comment on Study
Green, E. K.,2012 SNP: rs1006737, rs4765913 SNPs in CACNA1C were significantly associated with BD. Positive Comment on Study
Soeiro-de-Souza, M. G.,2012 SNP: rs1006737 CACNA1C genotype frequency was similar in both groups. Negative Comment on Study
Lett, T. A.,2011 SNP: rs1006737 No significant association was observed in CACNA1C gene for BPD. Negative Comment on Study
Chen, D. T.,2011 SNP: rs10848642 No significant association was observed. Negative Comment on Study
Soeiro-de-Souza, M. G.,2013(b) SNP: rs1006737 Our data indicate for the first time that the CACNA1C risk allele is likely associated with executive dysfunction as a trait in BD, as this association was found regardless the presence of mood symptoms. Larger studies should evaluate the potential influence of CACNA1C on other cognitive domains in BD. Positive Comment on Study
Cross-Disorder Group of the Psychiatric Genomics Consortium,2013 SNP: rs1024582, rs4765914 Significant association was observed in cross-disorder analysis. Positive Comment on Study
Gonzalez, S.,2013 SNP: rs769087, rs1006737, rs2159100, rs4765905, rs2370413, rs7297582, rs758170, rs1860002
Haplotype: rs769087 - rs1006737 - rs2159100 - rs4765905 - rs2370413 - rs7297582 - rs758170 - rs1860002(G-G-G-C-A-G-G-A), rs769087 - rs1006737 - rs2159100 - rs4765905 - rs2370413 - rs7297582 - rs758170 - rs1860002(A-A-A-G-G-A-A-G), rs769087 - rs1006737 - rs2159100 - rs4765905 - rs2370413 - rs7297582 - rs758170 - rs1860002(G-G-G-C-G-G-G-G), rs769087 - rs1006737 - rs2159100 - rs4765905 - rs2370413 - rs7297582 - rs758170 - rs1860002(G-G-G-C-G-G-G-A), rs769087 - rs1006737 - rs2159100 - rs4765905 - rs2370413 - rs7297582 - rs758170 - rs1860002(G-G-G-C-G-A-G-G), rs769087 - rs1006737 - rs2159100 - rs4765905 - rs2370413 - rs7297582 - rs758170 - rs1860002(A-A-A-G-G-G-A-G), rs769087 - rs1006737 - rs2159100 - rs4765905 - rs2370413 - rs7297582 - rs758170 - rs1860002(G-G-G-C-A-G-G-G), rs769087 - rs1006737 - rs2159100 - rs4765905 - rs2370413 - rs7297582 - rs758170 - rs1860002(G-G-G-C-G-A-G-A), rs769087 - rs1006737 - rs2159100 - rs4765905 - rs2370413 - rs7297582 - rs758170 - rs1860002(A-A-A-G-G-G-G-G), rs769087 - rs1006737 - rs2159100 - rs4765905 - rs2370413 - rs7297582 - rs758170 - rs1860002(G-G-G-C-G-G-A-G), rs769087 - rs1006737 - rs2159100 - rs4765905 - rs2370413 - rs7297582 - rs758170 - rs1860002(A-A-A-G-G-A-A-A), rs769087 - rs1006737 - rs2159100 - rs4765905 - rs2370413 - rs7297582 - rs758170 - rs1860002(G-G-G-C-A-A-G-A), rs769087 - rs1006737 - rs2159100 - rs4765905 - rs2370413 - rs7297582 - rs758170 - rs1860002(A-A-A-G-A-G-G-A), rs769087 - rs1006737 - rs2159100 - rs4765905 - rs2370413 - rs7297582 - rs758170 - rs1860002(G-A-A-G-G-A-A-G)
These results provide additional evidence that CACNA1C is associated with BP and provides the first evidence that variations in this gene might play a role in the pathogenesis of this disorder in the Latino population. Positive Comment on Study
Tesli, M.,2013 SNP: rs1006737 The risk allele of rs1006737 in CACNA1C was significantly associated with enhanced activity in the left amygdala ( in the BD group. Positive Comment on Study
Green, E. K., 2010 SNP: rs1006737 rs1006737 in this gene showed strong significance with BD Positive Comment on Study
Uemura, T., 2015 SNP: rs1006737 Our study further supports the association of SNP rs1006737 with BD-I and suggests that CACNA1C SNP rs1006737 and Bcl-2 SNP rs956572, or specific causal variants in LD with these proxies, act independently to increase risk and ICDH in BD-I. Positive Comment on Study
Moskvina, V.,2009 In BP:Smallest P-value per gene=0.03798, Product of P truncation <=0.01=0.0007, Product of P truncation <=0.001=0.00225. It showed evidence for association with BD. Positive Comment on Study
Fiorentino A., 2014 SNP: rs723672, rs75639014, rs190532500, rs181910852, rs55792866, rs113414207, rs79398153, rs116947827, rs73033311, rs117222543, rs1016388, rs12424245, rs2283290, rs11062159, rs11062161, rs10774034, rs3922316, rs2190771, rs10848642, rs11062162, rs4765904, rs1108222, rs1108074, rs1108073, rs2239030, rs2283291, rs2239033, rs3794297, rs144110899, rs112312080, rs73033370, rs148008322, rs180949249, rs146482058, rs138855206, rs2283295, rs191953785, rs2238061, rs112532048, rs10848683, rs10774053, rs10774054, rs11062319, rs67257957, rs3518, rs143803992, rs7316246, rs12809807, rs10466907, rs4765975, rs188226168, rs7957163, rs184753996, rs4765976, rs181496343
Other variant: CACNA1C_Chr12:2161733 _G/C, CACNA1C_Chr12:2161930 _C/T, CACNA1C_Chr12:2161934 _G/A, CACNA1C_Chr12:2161984 _C/A, CACNA1C_Chr12:2162059 _-/GGGG/CGGG/AGGG, CACNA1C_Chr12:2162201 _-/CGGCG, CACNA1C_Chr12:2162217 _G/A, CACNA1C_Chr12:2272007 _C/T, CACNA1C_Chr12:2284208 _-/TGTTCAAACCTGTGT, CACNA1C_Chr12:2286800 _-/TCTTTCTT, CACNA1C_Chr12:2286819 _-/TT, CACNA1C_Chr12:2286820 _-/T, CACNA1C_Chr12:2291321 _-/AT, CACNA1C_Chr12:2292413 _-/A, CACNA1C_Chr12:2292742 _-/C, CACNA1C_Chr12:2296694 _-/T, CACNA1C_Chr12:2296695 _GG/TGG, CACNA1C_Chr12:2297340 _-/CT, CACNA1C_Chr12:2297530 _-/CT, CACNA1C_Chr12:2300919 _-/CA, CACNA1C_Chr12:2300934 _-/CTCCACAGGCACAT, CACNA1C_Chr12:2301013 _-/CACT, CACNA1C_Chr12:2301016 _-/T, CACNA1C_Chr12:2301048 _-/G, CACNA1C_Chr12:2301049 _-/T, CACNA1C_Chr12:2301051 _-/C, CACNA1C_Chr12:2301188 _-/ATAC/ACAC, CACNA1C_Chr12:2302620 _-/A, CACNA1C_Chr12:2302621 _-/A/AA, CACNA1C_Chr12:2308364 _-/GG, CACNA1C_Chr12:2308644 _-/C, CACNA1C_Chr12:2314099 _AAAGTATAA/-, CACNA1C_Chr12:2314103 _-/A, CACNA1C_Chr12:2317001 _-/AA/AAA, CACNA1C_Chr12:2317010 _A/C, CACNA1C_Chr12:2317010 _AC/CC, CACNA1C_Chr12:2321310 _-/C, CACNA1C_Chr12:2323140 _-/T, CACNA1C_Chr12:2323807 _A/C, CACNA1C_Chr12:2328828 _A/T, CACNA1C_Chr12:2329069 _G/T, CACNA1C_Chr12:2332571 _T/-, CACNA1C_Chr12:2334223 _-/G, CACNA1C_Chr12:2335287 _-/CG, CACNA1C_Chr12:2335288 _-/CG/CGCG, CACNA1C_Chr12:2335298 _-/A/C, CACNA1C_Chr12:2335301 _-/G/A, CACNA1C_Chr12:2335333 _-/ACACACAG/ACACACAC, CACNA1C_Chr12:2335340 _-/G/C, CACNA1C_Chr12:2336695 _G/A, CACNA1C_Chr12:2338101 _-/TA/TATG, CACNA1C_Chr12:2338102 _-/TG, CACNA1C_Chr12:2338946 _G/A, CACNA1C_Chr12:2339781 _G/C, CACNA1C_Chr12:2341084 _-/T, CACNA1C_Chr12:2341393 _-/G, CACNA1C_Chr12:2341397 _G/T, CACNA1C_Chr12:2347245 _-/TT, CACNA1C_Chr12:2349920 _-/TGGCCTCCTCA, CACNA1C_Chr12:2349920 _GTGGCCTCCTCAT/GT, CACNA1C_Chr12:2352902 _G/A, CACNA1C_Chr12:2354984 _C/T, CACNA1C_Chr12:2362014 _G/C, CACNA1C_Chr12:2365088 _G/T, CACNA1C_Chr12:2365131 _C/T, CACNA1C_Chr12:2370397 _-/A, CACNA1C_Chr12:2370911 _-/ACACAC, CACNA1C_Chr12:2375362 _-/TT, CACNA1C_Chr12:2381652 _G/A, CACNA1C_Chr12:2385027 _-/A, CACNA1C_Chr12:2385246 _G/T, CACNA1C_Chr12:2389778 _G/A, CACNA1C_Chr12:2391029 _-/T, CACNA1C_Chr12:2392186 _-/T, CACNA1C_Chr12:2418658 _-/AC, CACNA1C_Chr12:2418658 _-/T/TAC, CACNA1C_Chr12:2418659 _AC/ACAC, CACNA1C_Chr12:2419508 _-/A, CACNA1C_Chr12:2419516 _A/T/AAT, CACNA1C_Chr12:2421980 _-/T, CACNA1C_Chr12:2423175 _G/C, CACNA1C_Chr12:2694668 _G/A, CACNA1C_Chr12:2788668 _C/G, CACNA1C_Chr12:2800689 _A/G, CACNA1C_Chr12:2800954 _GCACGGGCCACGCCGAGCTCCCGGCCA/-, CACNA1C_Chr12:2801016 _C/G/CGCCGCCGGGAAGGG, CACNA1C_Chr12:2801133 _T/A, CACNA1C_Chr12:2803097 _T/G, CACNA1C_Chr12:2804191 _T/G, CACNA1C_Chr12:2804268 _T/-, CACNA1C_Chr12:2804832 _G/-, CACNA1C_Chr12:2806546 _G/A, rs113329024
Genetic markers in the genes a-calcium channel subunit (CACNA1C) is associated with bipolar disorder (BP). Positive Comment on Study
Sklar, P.,2011 SNP: rs4765913 Significant association was found in combined analysis . Positive Comment on Study
Jogia, J.,2011 SNP: rs1006737 The present findings suggest that the CACNA1C rs1006737 polymorphism impacts on vlPFC activation during fear processing in BD carriers of the risk allele but not their unaffected relatives. Positive Comment on Study
Liu, Y.,2011 SNP: rs1006737, rs7297582 In conclusion, this analysis provides support for a role of CACNA1C risk variants for both bipolar and unipolar major mood disorders. Positive Comment on Study
Jan, W. C., 2014 SNP: rs1006737, rs10848635 Weak associations for CACNA1C (rs10848635) genes were observed. Positive Comment on Study
Perrier, E.,2011 SNP: rs1006737 An interaction between genotype and diagnosis was observed in the left putamen.Our results suggest that genetic variation may be an additional and important source of variability and reinforce the role of striatal changes for disease expression in BD. Positive Comment on Study
Gene functional annotation
Gene related GO terms (count: 40)

GO terms by PBA (count: 7)

GO terms by database search (count: 33)


Gene related KEGG pathways (count: 5)

KEGG pathways by PBA (count: 3)

KEGG pathways by database search (count: 2)


Gene related BioCarta pathways (count: 0)

Gene related interactors from protein-protein interactions data in HPRD (count: 8)

Related other genetic factors
Gene related SNPs (count: 167)

Literature-origin SNPs (count: 72)

LD-proxies (count: 95)


Gene related CNVs (count: 0)

Gene related other variants (count: 93)

Gene related regions (count: 2)

Overlap with schizophrenia (SZ) and major depressive disorder (MDD)
Gene relationship with SZ

Overlap with SZ from cross-disorder studies (count: 5)

Overlap with SZ from candidate gene intersection analysis (count: 2)


Gene relationship with MDD

Overlap with MDD from cross-disorder studies (count: 5)

Overlap with MDD from candidate gene intersection analysis (count: 0)


View in gBrowse

Region: chr12:1970786..2697950 View in gBrowse
View in gBrowse