Search SNP
Search Gene
Search CNV
Search Haplotype
Search Other Variant
Search Region
Search Pathway
Search Study
Study Report
| Comment on Study | View All Comments on Study |
Basic Info
| Reference | Fiorentino A., 2014 PMID: 24716743 |
|---|---|
| Citation | Fiorentino, A., et al. (2014). "Analysis of ANK3 and CACNA1C variants identified in bipolar disorder whole genome sequence data." Bipolar Disord. |
| Disease Type | Bipolar Disorder |
| Study Design | case-control |
| Study Type | Mutational study and candidate-gene association study |
| Sample Size | 1510 BP cases and 1095 controls |
| SNP/Region/Marker Size | 82 ANK3 and 43 CACNA1C variants; 108 CACNA1C variants |
| Predominant Ethnicity | Caucasian |
| Population | European |
| Age Group | adults |
Detail Info
| Sample Diagnosis | NHS clinical diagnosis of ICD-10 BP and SADS-L |
|---|---|
| Sample Status | The first cohort, UCL1, included 506 research subjects with bipolar I disorder (BP-I), defined by the presence of mania and hospitalization according to Research Diagnostic Criteria (RDC). UCL1 was included in the previously reported mega-analysis by the Psychiatric Genetic Consortium(PGC) BP GWAS. The second and third cohorts, UCL2 and UCL3, consisted, respectively, of 593 and 411 subjects with BP-I or bipolar II disorder (BP-II). Ancestry screening was used as a selection criterion for the inclusion of cases. |
| Technique | The genomic DNA was sequenced using 100 bp paired-end reads on a Hi-Seq 1000 (Illumina Inc., San Diego, CA, USA). Sequence data alignment to the National Center for Biotechnology Information human reference genome 37.1 (hg19) and variant calling was performed using the CASAVA 1.8.2 pipeline at Illumina. The sequence data from these individuals were further analysed and annotated using kGAP (Knome Inc., Boston, MA,USA).Genotyping was performed in-house with allele-specific polymerase chain reaction (PCR) using KASPar reagents (KBiosciences, Hoddesdon, UK) on a LightCycler 480 (Roche, Burgess Hill, UK) real-time PCR machine. ANK3 and CACNA1C non-synonymous variants present in the coding exons were identified using the Knome VARIANTS software. |
| Statistical Method | A burden analysis was performed on the data separately for ANK3 and CACNA1C. A chi-square test was used to compare the numbers of case and control individuals carrying one or more of the variant alleles against the numbers of case and control individuals who were found to be homozygous for the reference alleles at all of the loci tested. Haplotype analysis was performed using Haploview to determine the LD between GWAS-associated SNPs and the rare variants reported here. Haplotype blocks were determined using a solid spine of LD (D'= 1). |
| Result Summary | We found that the CACNA1C intron 3 variant, rs79398153, potentially affecting an ENCyclopedia of DNA Elements (ENCODE)-defined region, showed an association with BP (p = 0.015). We also found the ANK3 BP-associated variant rs139972937, responsible for an asparagine to serine change (p = 0.042). However, a previous study had not found support for an association between rs139972937 and BP. The variants at ANK3 and CACNA1C previously known to be associated with BP were not in linkage disequilibrium with either of the two variants that we identified and these are therefore independent of the previous haplotypes implicated by genome-wide association. |
| SNP | Related Gene(s) | Allele Change | Risk Allele | Statistical Values | Author Comments | Result Category |
|---|---|---|---|---|---|---|
| rs1904398 | ANK3 | A/C | eurMLP=0.05 | No significant association was observed. No significant association was observed. | Negative | |
| rs1904397 | ANK3 | C/A | eurMLP=0.83 | No significant association was observed. No significant association was observed. | Negative | |
| rs723672 | CACNA1C CACNA1C-IT2 | C/T | eurMLP=0.27 | No significant association was observed. No significant association was observed. | Negative | |
| rs144130033 | ANK3 | -/TATATTA | eurMLP=27.68 | No significant association was observed. No significant association was observed. | Negative | |
| rs190532500 | CACNA1C CACNA1C-IT2 | G/A | eurMLP=0.67 | No significant association was observed. No significant association was observed. | Negative | |
| rs75639014 | CACNA1C CACNA1C-IT2 | C/T | eurMLP=1.01 | No significant association was observed. No significant association was observed. | Negative | |
| rs55792866 | CACNA1C | G/A | eurMLP=0.37 | No significant association was observed. No significant association was observed. | Negative | |
| rs181910852 | CACNA1C CACNA1C-IT2 | C/T | eurMLP=2.42 | No significant association was observed. No significant association was observed. | Negative | |
| rs7903279 | ANK3 | C/T | eurMLP=0.35 | No significant association was observed. No significant association was observed. | Negative | |
| rs139578151 | ANK3 | G/T | eurMLP=0.23 | No significant association was observed. No significant association was observed. | Negative | |
| rs1442548 | ANK3 | G/A | eurMLP=0.29 | No significant association was observed. No significant association was observed. | Negative | |
| rs1442547 | ANK3 | A/G | eurMLP=0.35 | No significant association was observed. No significant association was observed. | Negative | |
| rs151007800 | ANK3 | C/T | eurMLP=0.2 | No significant association was observed. No significant association was observed. | Negative | |
| rs74659950 | ANK3 | T/C | eurMLP=0 | No significant association was observed. No significant association was observed. | Negative | |
| rs184389434 | ANK3 | T/A | eurMLP=1.39; P-value=0.41 | Test of association with ANK3 and CACNA1C variants with bipo...... Test of association with ANK3 and CACNA1C variants with bipolar disorder More... | Negative | |
| rs112339619 | ANK3 | G/A | eurMLP=0.13 | No significant association was observed. No significant association was observed. | Negative | |
| rs16914794 | ANK3 | C/G | eurMLP=0.37 | No significant association was observed. No significant association was observed. | Negative | |
| rs181454508 | ANK3 | A/C | eurMLP=0.31 | No significant association was observed. No significant association was observed. | Negative | |
| rs117421224 | ANK3 | G/A | eurMLP=1.39 | No significant association was observed. No significant association was observed. | Negative | |
| rs41283526 | ANK3 | T/C | eurMLP=0.95 | No significant association was observed. No significant association was observed. | Negative | |
| rs34796699 | ANK3 | -/A | eurMLP=11.33 | No significant association was observed. No significant association was observed. | Negative | |
| rs77622274 | ANK3 | T/C | eurMLP=0.5 | No significant association was observed. No significant association was observed. | Negative | |
| rs1551684 | ANK3 | G/A | eurMLP=0.48 | No significant association was observed. No significant association was observed. | Negative | |
| rs1551683 | ANK3 | C/T | eurMLP=0.48 | No significant association was observed. No significant association was observed. | Negative | |
| rs28932171 | ANK3 | T/C | eurMLP=0.07 | No significant association was observed. No significant association was observed. | Negative | |
| rs41274672 | ANK3 | C/G | eurMLP=0.2 | No significant association was observed. No significant association was observed. | Negative | |
| rs11599164 | ANK3 | G/T | eurMLP=0.07 | No significant association was observed. No significant association was observed. | Negative | |
| rs139972937 | ANK3 | T/C | eurMLP=1.39; P-value=0.042 | The non-synonymous ANK3 variant rs139972937 was found to be ...... The non-synonymous ANK3 variant rs139972937 was found to be associated with BP. More... | Positive | |
| rs148904927 | ANK3 | A/G | eurMLP=0.37 | No significant association was observed. No significant association was observed. | Negative | |
| rs117475706 | ANK3 | G/A | eurMLP=0.41 | No significant association was observed. No significant association was observed. | Negative | |
| rs2393595 | ANK3 | A/G | eurMLP=0.16 | No significant association was observed. No significant association was observed. | Negative | |
| rs6479694 | ANK3 | A/C | eurMLP=1.46 | No significant association was observed. No significant association was observed. | Negative | |
| rs139092048 | ANK3 | C/A | eurMLP=0.58 | No significant association was observed. No significant association was observed. | Negative | |
| rs141939315 | ANK3 | C/T | eurMLP=0.2 | No significant association was observed. No significant association was observed. | Negative | |
| rs149282429 | ANK3 | G/- | eurMLP=0.7 | No significant association was observed. No significant association was observed. | Negative | |
| rs181062313 | ANK3 | C/- | eurMLP=0.44 | No significant association was observed. No significant association was observed. | Negative | |
| rs10821668 | ANK3 | T/C | eurMLP=0.25 | No significant association was observed. No significant association was observed. | Negative | |
| rs140183285 | ANK3 | T/A | eurMLP=0.31 | No significant association was observed. No significant association was observed. | Negative | |
| rs61845768 | ANK3 | T/C | eurMLP=0.7 | No significant association was observed. No significant association was observed. | Negative | |
| rs147527383 | ANK3 | T/C | eurMLP=0.31 | No significant association was observed. No significant association was observed. | Negative | |
| rs1802665 | ANK3 | T/G | eurMLP=0.08 | No significant association was observed. No significant association was observed. | Negative | |
| rs187326819 | ANK3 | -/T | eurMLP=1.39 | No significant association was observed. No significant association was observed. | Negative | |
| rs8677 | ANK3 | T/A | eurMLP=0.64 | No significant association was observed. No significant association was observed. | Negative | |
| rs74155257 | ANK3 | G/T | eurMLP=0.2 | No significant association was observed. No significant association was observed. | Negative | |
| rs188594839 | ANK3 | G/- | eurMLP=0.44 | No significant association was observed. No significant association was observed. | Negative | |
| rs1049862 | ANK3 | G/A | eurMLP=0.15 | No significant association was observed. No significant association was observed. | Negative | |
| rs80034950 | ANK3 | C/T | eurMLP=0.98 | No significant association was observed. No significant association was observed. | Negative | |
| rs199763470 | ANK3 | T/G | eurMLP=1.39 | No significant association was observed. No significant association was observed. | Negative | |
| rs12257876 | ANK3 | C/A | eurMLP=0.58 | No significant association was observed. No significant association was observed. | Negative | |
| rs1050745 | ANK3 | C/T | eurMLP=1.71 | No significant association was observed. No significant association was observed. | Negative | |
| rs72816484 | ANK3 | C/T | eurMLP=0.13 | No significant association was observed. No significant association was observed. | Negative | |
| rs11816586 | ANK3 | C/T | eurMLP=0.46 | No significant association was observed. No significant association was observed. | Negative | |
| rs12265962 | ANK3 | T/G | eurMLP=0.2 | No significant association was observed. No significant association was observed. | Negative | |
| rs7078873 | ANK3 | T/A | eurMLP=1.05 | No significant association was observed. No significant association was observed. | Negative | |
| rs79598579 | ANK3 | C/T | eurMLP=0.37 | No significant association was observed. No significant association was observed. | Negative | |
| rs190133850 | ANK3 | A/T | eurMLP=0.7 | No significant association was observed. No significant association was observed. | Negative | |
| rs78682113 | ANK3 | C/T | eurMLP=0.2 | No significant association was observed. No significant association was observed. | Negative | |
| rs114693358 | ANK3 | C/T | eurMLP=0.7 | No significant association was observed. No significant association was observed. | Negative | |
| rs181496343 | CACNA1C | T/C | eurMLP=0.2 | No significant association was observed. No significant association was observed. | Negative | |
| rs4765976 | CACNA1C | A/C | eurMLP=0 | No significant association was observed. No significant association was observed. | Negative | |
| rs4765975 | CACNA1C CACNA1C-AS1 | T/A | eurMLP=0.43 | No significant association was observed. No significant association was observed. | Negative | |
| rs188226168 | CACNA1C | A/G | eurMLP=0.37 | No significant association was observed. No significant association was observed. | Negative | |
| rs7957163 | CACNA1C | A/C | eurMLP=0.43 | No significant association was observed. No significant association was observed. | Negative | |
| rs184753996 | CACNA1C | A/C | eurMLP=1.39 | No significant association was observed. No significant association was observed. | Negative | |
| rs143803992 | CACNA1C CACNA1C-AS1 | C/T | eurMLP=0.37 | No significant association was observed. No significant association was observed. | Negative | |
| rs7316246 | CACNA1C CACNA1C-AS1 | G/A | eurMLP=0.26 | No significant association was observed. No significant association was observed. | Negative | |
| rs12809807 | CACNA1C CACNA1C-AS1 | C/A | eurMLP=0.01 | No significant association was observed. No significant association was observed. | Negative | |
| rs10466907 | CACNA1C CACNA1C-AS1 | T/G | eurMLP=0.43 | No significant association was observed. No significant association was observed. | Negative | |
| rs10774054 | CACNA1C CACNA1C-AS1 | A/G | eurMLP=0 | No significant association was observed. No significant association was observed. | Negative | |
| rs11062319 | CACNA1C CACNA1C-AS1 | C/T | eurMLP=0.52 | No significant association was observed. No significant association was observed. | Negative | |
| rs67257957 | CACNA1C CACNA1C-AS1 | -/GCCGCCGGGAAGGG | eurMLP=200.63 | No significant association was observed. No significant association was observed. | Negative | |
| rs3518 | CACNA1C CACNA1C-AS1 | C/T | eurMLP=0.44 | No significant association was observed. No significant association was observed. | Negative | |
| rs2238061 | CACNA1C | G/A | eurMLP=1.36 | No significant association was observed. No significant association was observed. | Negative | |
| rs112532048 | CACNA1C | C/T | eurMLP=0.37 | No significant association was observed. No significant association was observed. | Negative | |
| rs10848683 | CACNA1C CACNA1C-AS1 | C/T | eurMLP=0.29 | No significant association was observed. No significant association was observed. | Negative | |
| rs10774053 | CACNA1C CACNA1C-AS1 | A/G | eurMLP=0.3 | No significant association was observed. No significant association was observed. | Negative | |
| rs191953785 | CACNA1C | C/T | eurMLP=2.09; P-value=0.34 | No significant association was observed. No significant association was observed. | Negative | |
| rs2283295 | CACNA1C | G/A | eurMLP=1.36 | No significant association was observed. No significant association was observed. | Negative | |
| rs138855206 | CACNA1C | G/A | eurMLP=1.56 | No significant association was observed. No significant association was observed. | Negative | |
| rs146482058 | CACNA1C CACNA1C-IT3 | -/T | eurMLP=7.03; P-value=0.31 | No significant association was observed. No significant association was observed. | Negative | |
| rs180949249 | CACNA1C CACNA1C-IT3 | -/A | eurMLP=1.73 | No significant association was observed. No significant association was observed. | Negative | |
| rs148008322 | CACNA1C | C/T | eurMLP=1.39 | No significant association was observed. No significant association was observed. | Negative | |
| rs73033370 | CACNA1C | G/A | eurMLP=1.33 | No significant association was observed. No significant association was observed. | Negative | |
| rs112312080 | CACNA1C | C/T | eurMLP=1.56; P-value=0.30 | No significant association was observed. No significant association was observed. | Negative | |
| rs144110899 | CACNA1C | C/T | eurMLP=2.16 | No significant association was observed. No significant association was observed. | Negative | |
| rs3794297 | CACNA1C | C/T | eurMLP=1.37 | No significant association was observed. No significant association was observed. | Negative | |
| rs2239033 | CACNA1C | A/C | eurMLP=1.37 | No significant association was observed. No significant association was observed. | Negative | |
| rs2283291 | CACNA1C CACNA1C-AS4 | G/A | eurMLP=1.37 | No significant association was observed. No significant association was observed. | Negative | |
| rs2239030 | CACNA1C CACNA1C-AS4 | G/A | eurMLP=1.37 | No significant association was observed. No significant association was observed. | Negative | |
| rs1108073 | CACNA1C CACNA1C-AS4 | C/T | eurMLP=1.89 | No significant association was observed. No significant association was observed. | Negative | |
| rs1108074 | CACNA1C CACNA1C-AS4 | C/T | eurMLP=1.32 | No significant association was observed. No significant association was observed. | Negative | |
| rs1108222 | CACNA1C CACNA1C-AS4 | A/C | eurMLP=1.34 | No significant association was observed. No significant association was observed. | Negative | |
| rs11062162 | CACNA1C CACNA1C-AS4 | G/A | eurMLP=1.89 | No significant association was observed. No significant association was observed. | Negative | |
| rs4765904 | CACNA1C CACNA1C-AS4 | A/C | eurMLP=1.32 | No significant association was observed. No significant association was observed. | Negative | |
| rs2190771 | CACNA1C CACNA1C-AS4 | G/T | eurMLP=1.32 | No significant association was observed. No significant association was observed. | Negative | |
| rs10848642 | CACNA1C CACNA1C-AS4 | G/A | eurMLP=1.32 | No significant association was observed. No significant association was observed. | Negative | |
| rs10774034 | CACNA1C CACNA1C-AS4 | C/T | eurMLP=1.57 | No significant association was observed. No significant association was observed. | Negative | |
| rs3922316 | CACNA1C CACNA1C-AS4 | A/C | eurMLP=1.32 | No significant association was observed. No significant association was observed. | Negative | |
| rs11062159 | CACNA1C CACNA1C-AS4 | G/A | eurMLP=1.34 | No significant association was observed. No significant association was observed. | Negative | |
| rs11062161 | CACNA1C CACNA1C-AS4 | C/T | eurMLP=1.89 | No significant association was observed. No significant association was observed. | Negative | |
| rs12424245 | CACNA1C | G/A | eurMLP=1.34 | No significant association was observed. No significant association was observed. | Negative | |
| rs2283290 | CACNA1C | G/A/T | eurMLP=1.74 | No significant association was observed. No significant association was observed. | Negative | |
| rs117222543 | CACNA1C | G/C | eurMLP=1.39 | No significant association was observed. No significant association was observed. | Negative | |
| rs1016388 | CACNA1C | A/T | eurMLP=1.66 | No significant association was observed. No significant association was observed. | Negative | |
| rs116947827 | CACNA1C | C/T | eurMLP=2.16 | No significant association was observed. No significant association was observed. | Negative | |
| rs73033311 | CACNA1C | C/T | eurMLP=1.39 | No significant association was observed. No significant association was observed. | Negative | |
| rs113414207 | CACNA1C | -/C | eurMLP=1.39; P-value=0.19 | No significant association was observed. No significant association was observed. | Negative | |
| rs79398153 | CACNA1C | C/T | eurMLP=2.16; P-value=0.015 | Of the SNPs found in the CACNA1C intronic region, rs79398153...... Of the SNPs found in the CACNA1C intronic region, rs79398153 was found to be associated with BP (Fisher’s exact test p=0.015). More... | Positive |
| Variant Name | Related Gene | Type | Allele Change | Risk Allele | Statistical Values | Author Comments | Result Category |
|---|---|---|---|---|---|---|---|
| rs113329024 | CACNA1C | insertion | -/T | eurMLP=31.37 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2335301 -/G/A | CACNA1C | insertion/deletion | -/G/A | eurMLP=2.09 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2335333 -/ACACACAG/ACACACAC | CACNA1C | insertion/deletion | -/ACACACAG/ACACACAC | eurMLP=1.39 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2335340 -/G/C | CACNA1C | insertion/deletion | -/G/C | eurMLP=1.39 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2336695 G/A | CACNA1C | point mutation | G/A | eurMLP=1.39 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2338101 -/TA/TATG | CACNA1C | insertion/deletion | -/TA/TATG | eurMLP=9.89 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2338102 -/TG | CACNA1C | insertion/deletion | -/TG | eurMLP=8.45 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2338946 G/A | CACNA1C | point mutation | G/A | eurMLP=1.39 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2339781 G/C | CACNA1C | point mutation | G/C | eurMLP=1.39 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2323807 A/C | CACNA1C | point mutation | A/C | eurMLP=1.39 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2328828 A/T | CACNA1C | point mutation | A/T | eurMLP=1.39 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2329069 G/T | CACNA1C | point mutation | G/T | eurMLP=1.39 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2332571 T/- | CACNA1C | insertion/deletion | T/- | eurMLP=0.7 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2334223 -/G | CACNA1C | insertion/deletion | -/G | eurMLP=1.39 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2335287 -/CG | CACNA1C | insertion/deletion | -/CG | eurMLP=1.39 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2335288 -/CG/CGCG | CACNA1C | insertion/deletion | -/CG/CGCG | eurMLP=2.09 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2335298 -/A/C | CACNA1C | insertion/deletion | -/A/C | eurMLP=5.61 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2365088 G/T | CACNA1C | point mutation | G/T | eurMLP=101.1 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2362014 G/C | CACNA1C | point mutation | G/C | eurMLP=1.39 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2370397 -/A | CACNA1C | insertion/deletion | -/A | eurMLP=4.9 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2365131 C/T | CACNA1C | point mutation | C/T | eurMLP=7.03 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2375362 -/TT | CACNA1C | insertion/deletion | -/TT | eurMLP=7.03 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2370911 -/ACACAC | CACNA1C | insertion/deletion | -/ACACAC | eurMLP=7.03 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2385027 -/A | CACNA1C | insertion/deletion | -/A | eurMLP=7.03 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2381652 G/A | CACNA1C | point mutation | G/A | eurMLP=1.39 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2341393 -/G | CACNA1C | insertion/deletion | -/G | eurMLP=1.39 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2341084 -/T | CACNA1C | insertion/deletion | -/T | eurMLP=1.39 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2347245 -/TT | CACNA1C | insertion/deletion | -/TT | eurMLP=1.39 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2341397 G/T | CACNA1C | point mutation | G/T | eurMLP=2.79 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2349920 GTGGCCTCCTCAT/GT | CACNA1C | insertion/deletion | GTGGCCTCCTCAT/GT | eurMLP=4.9 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2349920 -/TGGCCTCCTCA | CACNA1C | insertion/deletion | -/TGGCCTCCTCA | eurMLP=4.9 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2354984 C/T | CACNA1C | point mutation | C/T | eurMLP=1.39 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2352902 G/A | CACNA1C | point mutation | G/A | eurMLP=1.39 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2423175 G/C | CACNA1C | point mutation | G/C | eurMLP=1.39 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2694668 G/A | CACNA1C | point mutation | G/A | eurMLP=1.39 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2419516 A/T/AAT | CACNA1C | point mutation/duplication | A/T/AAT | eurMLP=5.61 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2421980 -/T | CACNA1C | insertion/deletion | -/T | eurMLP=2.09 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2800954 GCACGGGCCACGCCGAGCTCCCGGCCA/- | CACNA1C | insertion/deletion | GCACGGGCCACGCCGAGCTCCCGGCCA/- | eurMLP=0.7 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2801016 C/G/CGCCGCCGGGAAGGG | CACNA1C | point mutation/insertion | C/G/CGCCGCCGGGAAGGG | eurMLP=7.74 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2788668 C/G | CACNA1C | point mutation | C/G | eurMLP=0.44 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2800689 A/G | CACNA1C | point mutation | A/G | eurMLP=0.7 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2391029 -/T | CACNA1C | insertion/deletion | -/T | eurMLP=1.39 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2392186 -/T | CACNA1C | insertion/deletion | -/T | eurMLP=1.39 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2385246 G/T | CACNA1C | point mutation | G/T | eurMLP=7.03 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2389778 G/A | CACNA1C | point mutation | G/A | eurMLP=7.03 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2418659 AC/ACAC | CACNA1C | duplication | AC/ACAC | eurMLP=2.09 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2419508 -/A | CACNA1C | insertion/deletion | -/A | eurMLP=6.32 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2418658 -/AC | CACNA1C | insertion/deletion | -/AC | eurMLP=2.09 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2418658 -/T/TAC | CACNA1C | insertion/deletion | -/T/TAC | eurMLP=2.79 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2804268 T/- | CACNA1C | insertion/deletion | T/- | eurMLP=0.26 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2804191 T/G | CACNA1C | point mutation | T/G | eurMLP=0.7 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2803097 T/G | CACNA1C | point mutation | T/G | eurMLP=0.7 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2801133 T/A | CACNA1C | point mutation | T/A | eurMLP=0.7 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2806546 G/A | CACNA1C | point mutation | G/A | eurMLP=0.7 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2804832 G/- | CACNA1C | insertion/deletion | G/- | eurMLP=0.01 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2308644 -/C | CACNA1C | insertion/deletion | -/C | eurMLP=1.39 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2314099 AAAGTATAA/- | CACNA1C | insertion/deletion | AAAGTATAA/- | eurMLP=1.39 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2314103 -/A | CACNA1C | insertion/deletion | -/A | eurMLP=3.49 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2317001 -/AA/AAA | CACNA1C | insertion/deletion | -/AA/AAA | eurMLP=82.17 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2317010 A/C | CACNA1C | point mutation | A/C | eurMLP=1.45 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2317010 AC/CC | CACNA1C | point mutation | AC/CC | eurMLP=1.45 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2321310 -/C | CACNA1C | insertion/deletion | -/C | eurMLP=1.39 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2323140 -/T | CACNA1C | insertion/deletion | -/T | eurMLP=82.17 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2301016 -/T | CACNA1C | insertion/deletion | -/T | eurMLP=1.78 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2301048 -/G | CACNA1C | insertion/deletion | -/G | eurMLP=78.06 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2301049 -/T | CACNA1C | insertion/deletion | -/T | eurMLP=78.06 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2301051 -/C | CACNA1C | insertion/deletion | -/C | eurMLP=78.06 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2301188 -/ATAC/ACAC | CACNA1C | insertion/deletion | -/ATAC/ACAC | eurMLP=83.2 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2302620 -/A | CACNA1C | insertion/deletion | -/A | eurMLP=1.39 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2302621 -/A/AA | CACNA1C | insertion/deletion | -/A/AA | eurMLP=85.27 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2308364 -/GG | CACNA1C | insertion/deletion | -/GG | eurMLP=1.39 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2296694 -/T | CACNA1C | insertion/deletion | -/T | eurMLP=89.44 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2292742 -/C | CACNA1C | insertion/deletion | -/C | eurMLP=1.39 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2297340 -/CT | CACNA1C | insertion/deletion | -/CT | eurMLP=1.39 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2296695 GG/TGG | CACNA1C | insertion/deletion | GG/TGG | eurMLP=89.44 | No significant association was observed. No significant association was observed. | Negative | |
| rs3045444 | ANK3 | eurMLP=4.19 | No significant association was observed. No significant association was observed. | Negative | |||
| CACNA1C Chr12:2300919 -/CA | CACNA1C | insertion/deletion | -/CA | eurMLP=1.39 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2297530 -/CT | CACNA1C | insertion/deletion | -/CT | eurMLP=98.96 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2301013 -/CACT | CACNA1C | insertion/deletion | -/CACT | eurMLP=1.78 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2300934 -/CTCCACAGGCACAT | CACNA1C | insertion/deletion | -/CTCCACAGGCACAT | eurMLP=2.09 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2272007 C/T | CACNA1C | point mutation | C/T | eurMLP=2.09 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2162217 G/A | CACNA1C | point mutation | G/A | eurMLP=4.19 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2286800 -/TCTTTCTT | CACNA1C | insertion/deletion | -/TCTTTCTT | 1eurMLP=4.97 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2284208 -/TGTTCAAACCTGTGT | CACNA1C | insertion/deletion | -/TGTTCAAACCTGTGT | eurMLP=4.9 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2286820 -/T | CACNA1C | insertion/deletion | -/T | eurMLP=2.79 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2286819 -/TT | CACNA1C | insertion/deletion | -/TT | eurMLP=2.79 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2292413 -/A | CACNA1C | insertion/deletion | -/A | 8eurMLP=2.17 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2291321 -/AT | CACNA1C | insertion/deletion | -/AT | eurMLP=1.39 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2161733 G/C | CACNA1C | point mutation | G/C | eurMLP=0.7 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2161930 C/T | CACNA1C | point mutation | C/T | eurMLP=0.7 | No significant association was observed. No significant association was observed. | Negative | |
| ANK3 Chr10:62494113 C/T | ANK3 | point mutation | C/T | eurMLP=0.7 | No significant association was observed. No significant association was observed. | Negative | |
| ANK3 Chr10:62494201 CT/CTATATTAT | ANK3 | insertion/deletion | CT/CTATATTAT | eurMLP=0.97 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2162059 -/GGGG/CGGG/AGGG | CACNA1C | insertion/deletion | -/GGGG/CGGG/AGGG | 1eurMLP=0.61 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2162201 -/CGGCG | CACNA1C | insertion/deletion | -/CGGCG | eurMLP=0.7 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2161934 G/A | CACNA1C | point mutation | G/A | eurMLP=1.39 | No significant association was observed. No significant association was observed. | Negative | |
| CACNA1C Chr12:2161984 C/A | CACNA1C | point mutation | C/A | eurMLP=0.7 | No significant association was observed. No significant association was observed. | Negative | |
| ANK3 Chr10:62332894 -/A | ANK3 | insertion/deletion | -/A | eurMLP=0.7 | No significant association was observed. No significant association was observed. | Negative | |
| ANK3 Chr10:62332895 A/AA | ANK3 | duplication | A/AA | eurMLP=0.7 | No significant association was observed. No significant association was observed. | Negative | |
| ANK3 Chr10:62149642 C/T | ANK3 | point mutation | C/T | eurMLP=0.7 | No significant association was observed. No significant association was observed. | Negative | |
| ANK3 Chr10:62150190 G/A | ANK3 | point mutation | G/A | eurMLP=0.7 | No significant association was observed. No significant association was observed. | Negative | |
| ANK3 Chr10:62493812 G/C | ANK3 | point mutation | G/C | eurMLP=0.7 | No significant association was observed. No significant association was observed. | Negative | |
| ANK3 Chr10:62494029 A/G | ANK3 | point mutation | A/G | eurMLP=0.7 | No significant association was observed. No significant association was observed. | Negative | |
| ANK3 Chr10:62332985 T/- | ANK3 | insertion/deletion | T/- | eurMLP=2.09 | No significant association was observed. No significant association was observed. | Negative | |
| ANK3 Chr10:62333120 ACCAACCA/- | ANK3 | insertion/deletion | ACCAACCA/- | eurMLP=0.2 | No significant association was observed. No significant association was observed. | Negative | |
| ANK3 Chr10:61900857 G/A | ANK3 | point mutation | G/A | eurMLP=0.7 | No significant association was observed. No significant association was observed. | Negative | |
| ANK3 Chr10:61900727 G/C | ANK3 | point mutation | G/C | eurMLP=0.7 | No significant association was observed. No significant association was observed. | Negative | |
| ANK3 Chr10:61900256 G/A | ANK3 | point mutation | G/A | eurMLP=0.7 | No significant association was observed. No significant association was observed. | Negative | |
| ANK3 Chr10:61843365 C/G | ANK3 | point mutation | C/G | eurMLP=0.31 | No significant association was observed. No significant association was observed. | Negative | |
| ANK3 Chr10:61958307 G/T | ANK3 | point mutation | G/T | eurMLP=0.44 | No significant association was observed. No significant association was observed. | Negative | |
| ANK3 Chr10:61941143 C/G | ANK3 | point mutation | C/G | eurMLP=0.7 | No significant association was observed. No significant association was observed. | Negative | |
| ANK3 Chr10:61901321 T/G | ANK3 | point mutation | T/G | eurMLP=0.7 | No significant association was observed. No significant association was observed. | Negative | |
| ANK3 Chr10:61901317 -/TG | ANK3 | insertion/deletion | -/TG | eurMLP=0.7 | No significant association was observed. No significant association was observed. | Negative | |
| ANK3 Chr10:61789498 AC/- | ANK3 | insertion/deletion | AC/- | eurMLP=0.7 | No significant association was observed. No significant association was observed. | Negative | |
| ANK3 Chr10:61788626 G/T | ANK3 | point mutation | G/T | eurMLP=1.39 | No significant association was observed. No significant association was observed. | Negative | |
| ANK3 Chr10:61787065 TA/- | ANK3 | insertion/deletion | TA/- | eurMLP=0.7 | No significant association was observed. No significant association was observed. | Negative | |
| ANK3 Chr10:61786761 A/G | ANK3 | point mutation | A/G | eurMLP=0.7 | No significant association was observed. No significant association was observed. | Negative | |
| ANK3 Chr10:61841574 T/- | ANK3 | insertion/deletion | T/- | eurMLP=0.79 | No significant association was observed. No significant association was observed. | Negative | |
| ANK3 Chr10:61819783 T/G | ANK3 | point mutation | T/G | eurMLP=0.44 | No significant association was observed. No significant association was observed. | Negative | |
| ANK3 Chr10:61789556 C/- | ANK3 | insertion/deletion | C/- | eurMLP=0.7 | No significant association was observed. No significant association was observed. | Negative | |
| ANK3 Chr10:61789512 C/- | ANK3 | insertion/deletion | C/- | eurMLP=0.7 | No significant association was observed. No significant association was observed. | Negative |
| Gene | Statistical Values/Author Comments | Result Category |
|---|---|---|
| ANK3 | Genetic markers in the genes encoding ankyrin 3 (ANK3) is associated with bipolar disorder (BP). Genetic markers in the genes encoding ankyrin 3 (ANK3) is associated with bipolar disorder (BP). | Positive |
| CACNA1C | Genetic markers in the genes a-calcium channel subunit (CACNA1C) is associated with bipolar disorder...... Genetic markers in the genes a-calcium channel subunit (CACNA1C) is associated with bipolar disorder (BP). More... | Positive |
Copyright: Bioinformatics Lab, Institute of Psychology, Chinese Academy of Sciences Feedback
Acknowledgements
To view this website normally, please make sure to allow Flash to run from the local filesystem in the security settings panel.
Last update: March 31, 2016