SNP Report

Basic Info

Name	rs28360071 dbSNP Ensembl
Location	chr5:83142293 - 83142322(1)
Variant Alleles	GATGAGGAAACTAACTCTCAGTGGTGTTTA/-
Minor Allele	-
Minor Allele Frequence	0.45647
Functional Annotation	intron_variant; non_coding_transcript_variant.
Consequence to Transcript	intron_variant(ENST00000282268, ENST00000338635, ENST00000396027, ENST00000509268, ENST00000511817, ENST00000542685); non_coding_transcript_variant(ENST00000509268, ENST00000542685)
No. of Studies	1 (Positive: 0; Negative: 1; Trend: 0)
Source	Literature
Overlap with SZ?	NO
Overlap with MDD?	NO

SNP related studies (count: 1)

Reference	Allele Change	Risk Allele	Statistical Values	Author Comments	Result Category
Kazemi-Noughabi, M., 2016			P>0.05 P>0.05	The genotypic frequency for the rs28360071 polymorphism amon...... The genotypic frequency for the rs28360071 polymorphism among the controls was in Hardyâ€“Weinberg equilibrium (P>0.05). More...	Negative

SNP related genes (count: 1)

Approved Symbol	Approved Name	Location	No. of Studies (Positive/Negative/Trend)
XRCC4	X-ray repair complementing defective repair in Chinese hamster cells 4	5q14.2	1(0/1/0)

SNPs in LD with rs28360071 (count: 0) View in gBrowse (chr5:83142293..83142322 )

Overlap with SZ from cross-disorder studies (count: 0)

Overlap with MDD from cross-disorder studies (count: 0)