BDgene

SNP Report

Basic Info
Name rs28360071 dbSNP Ensembl
Location chr5:83142293 - 83142322(1)
Variant Alleles GATGAGGAAACTAACTCTCAGTGGTGTTTA/-
Minor Allele -
Minor Allele Frequence 0.45647
Functional Annotation intron_variant; non_coding_transcript_variant.
Consequence to Transcript intron_variant(ENST00000282268, ENST00000338635, ENST00000396027, ENST00000509268, ENST00000511817, ENST00000542685); non_coding_transcript_variant(ENST00000509268, ENST00000542685)
No. of Studies 1 (Positive: 0; Negative: 1; Trend: 0)
Source Literature
Overlap with SZ? NO
Overlap with MDD? NO

SNP related studies (count: 1)
Reference Allele Change Risk Allele Statistical Values Author Comments Result Category
Kazemi-Noughabi, M., 2016 P>0.05 P>0.05 The genotypic frequency for the rs28360071 polymorphism amon...... The genotypic frequency for the rs28360071 polymorphism among the controls was in Hardy–Weinberg equilibrium (P>0.05). More... Negative

SNP related genes (count: 1)
Approved Symbol Approved Name Location No. of Studies (Positive/Negative/Trend)
XRCC4 X-ray repair complementing defective repair in Chinese hamster cells 4 5q14.2 1(0/1/0)

SNPs in LD with rs28360071 (count: 0) View in gBrowse (chr5:83142293..83142322 )

Overlap with SZ from cross-disorder studies (count: 0)

Overlap with MDD from cross-disorder studies (count: 0)